C Programming

The score table will be printed by reading the match information made between the teams.

It is not known how many teams. The team information will be kept in a dynamically changed memory area as the new team enters. The match list should also be kept in a dynamic area that is recorded as new match information is entered.

There should be 2 structs in the program.

Mac struct: Consists of 1st team name, 2nd team name, 1st team goal, 2nd team goal information.

Team struct: consists of team name (one word, 20), number of wins, number of draws, number of defeats, number of goals scored, number of goals eaten, point.

Example input: abc xyz 3 1 (Information will be entered completely and correctly.)

A single line of match information, with a space between them, 1 Team name, 2 Team name, 1.

The goal scored by the team will be entered as the goal scored by the 2nd team. In the case where the above example is the first match information entered for these teams, two teams will be identified in the abc and xyz names, and will be added to the team list, since there are no teams defined in these names yet. At the same time, a match struct will be defined, this match struct will be added to the match list, and all information of both teams in the team struct will be updated with this match information.

If the above example is not the first match information entered about the abc and xyz teams, since both teams will be defined before, these teams will be found in the teams list and their relevant information will be updated.

In summary, for the above entry, if the team has not yet been identified in these names, both teams will be identified and added to the team list. The number of victories of the ABC team will be increased by one, the number of goals scored will be increased by 3, the number of goals scored will be increased by 1, and the score will be increased by 3. The xyz team's number of defeats will be increased by 1, the goal scored will be increased by 1, the goal it has scored will be increased by 3, its score will be reduced by 1. (wins 3 points, draw 1 point, defeat -1 point). The match struct will be added to the match list.

After entering the match information, the scoreboard will be printed.

Scoreboard: The information in the team struct will be printed one after the other in the order given in the description. The scoreboard should be in descending order according to the score. In case of score equality, the team with a high average score (goals scored and goals scored) should be on the top. It can be assumed that the score and average will not be equal teams.

After the scoreboard is printed, the user will receive a sequence number from 1-teamnumber, and the matches of the team in the row entered will be listed. Unless -1 is entered, the sequence number will be read again after printing the information of a tool, and the program will end when -1 is entered. If a number between 1-teamnumber or an entry other than -1 has been made, an appropriate message will be given and the entry will be waited again.

Convert the following switch statement into if-else statements:

int month = input.nextInt();
switch (month) {

case 1: System.out.println(“January”);

case 2: System.out.println(“February”); break;

case 3: System.out.println(“March”); break;

case 4: System.out.println(“April”);

case 5: System.out.println(“May”); break;

default: System.out.println(“Invalid”); break;

}

example:

if (month == 1) {

System.out.println("January");

System.out.println("February"); }
if (month == 2)
{ System.out.println("February");
  
}
}
}

Please continue the code! Thanks

IV. More practice with momentum and collisions A. A skater of mass 45.0 kg standing on ice throws a stone of mass 7.65 kg with a speed of 20.9 m/s in a horizontal direction. Find: 1. The speed of the skater after throwing the stone. 2. The distance over which the skater will move in the opposite direction if the coefficient of kinetic friction between his skates and the ice is 0.03. Include an energy bar chart in your solution. B. A tall man walking at 1.25 m/s accidentally bumps his head of mass 2.95 kg on a steel doorframe. His head stops in 0.011 s. 1. What is the magnitude of the average force exerted by the doorframe on the man's head? 2. Explain why putting padding on the doorframe would help reduce this force.

Thermal Rising, Inc., makes paragliders for sale through specialty sporting goods stores. The company has a standard paraglider model, but also makes custom-designed paragliders. Management has designed an activity-based costing system with the following activity cost pools and activity rates:

Management would like an analysis of the profitability of a particular customer, Big Sky Outfitters, which has ordered the following products over the last 12 months:

The company’s direct labor rate is $18 per hour.

Required:

Using the company’s activity-based costing system, compute the customer margin of Big Sky Outfitters. (Round your intermediate calculations and final answer to the nearest whole dollar amount. Loss amounts should be entered with a minus sign.)

Explain what the following Scheme code is doing:

(define (make-stream n f)
  (define (next m)
    (cons m (lambda () (next (f m)))))
  (next n))

(define head car)

(define (tail stream)
  ((cdr stream)))

(define (nth stream n)
  (if (= n 0) (head stream)
    (nth (tail stream) (- n 1))))

(define even (make-stream 0 (lambda (n) (+ n 2))))

Try it out in Scheme48 and check the values of the following expressions:

even
(head even)
(head (tail even))
(head (tail (tail even)))
(head (tail (tail (tail even))))
(nth even 5)
(nth even 1000)

Explain what the lambda in make-stream is good for, where this function is called, and how tail and nth work. To see what’s going on, trace manually through the execution of

(head (tail (tail even)))

Background: The advantage of wireless signals is that they radiate out in all directions, even penetrating walls to a certain extent. Of course, the very ability of wireless signals also causes problems.

Answer the following questions:

• Describe a situation where we would want to block a wireless signal
• Describe a method to block the signal and provide a link to a source for your method or materials
• Give at least one reason why someone might find your solution impractical

A gas expands from an initial volume of 4.88 L to a final volume of 6.33 L against an external pressure of 810. mmHg. During the expansion the gas absorbs 10. J of heat. What is the change in the internal energy of the gas?

An organic liquid is a mixture of methyl alcohol (CH3OH) and ethyl alcohol (C2H5OH). A 0.220-g sample of the liquid is burned in an excess of O2(g) and yields 0.347 g CO2(g) (carbon dioxide).

Set up two algebraic equations, one expressing the mass of carbon dioxide produced in terms of each reagent and the other expressing the mass of sample burned in terms of each reagent.

What is the mass of methyl alcohol (CH3OH) in the sample?

List the allowed quantum numbers m_l and m_s for the following subshells and determine the maximum occupancy of the subshells. a) 2p b) 3d c) 4f d) 5g

Vancouver manufacturing Ltd. manufactures a variety of high quality electronic components. Data from the last three months are presented below:

You are the controller for Vancouver manufacturing and you are reviewing the performance over the last 3 months. In addition, the controller notes that the company, although it has many detailed performance measures, is considering implementing a balanced scorecard and asks you to identify the measures you think would be most appropriate to include in the balanced scorecard.

Required:

Evaluate the performance of the company and prepare a detailed Balanced Scorecard.

IN PSEUDOCODE AND JAVA SOURCE CODE PLEASE:

Program 0 (Warm-up, 40 pts): Deoxyribonucleic acid, or DNA, is comprised of four bases: (G)uanine, (C)ytosine, (A)denine and (T)hymine. Ribonucleic acid, or RNA, is different than DNA in that it contains no Thymine; thymine is replaced with something called (U)racil. For this assignment, you will create an array of 255 characters. You must start by filling the array with random characters of G, C, A and T.   You must then print out the array. Next, replace all the instances of Thymine with Uracil. Finally, you must print out the array again. In your solution, you must write at least one function that contributes to the solution. You must use the length attribute of the array in your answer.

Sample run

CATGGCGTCTTGCCAAGGCGGTTCCTTGTCTTGATGATGGCTGCGAGTTCCGAGTCGCCTTTTCTATGAGTCGCGAAGTATGCGGTCAAATTATGCTTGTCCGCTGTACTAGGCCCACGGATCTCCTCAGACAGCGTCGATGTCGGAATTCGCGGGGAGGAATACTAAACATGCTGAAGTTGATACATGTACAATTGCCGCGAACCAGGTGCACAGGGTGCCCAACGATCCATGTGGAACGAGAGCGATCTAGCC

CAUGGCGUCUUGCCAAGGCGGUUCCUUGUCUUGAUGAUGGCUGCGAGUUCCGAGUCGCCUUUUCUAUGAGUCGCGAAGUAUGCGGUCAAAUUAUGCUUGUCCGCUGUACUAGGCCCACGGAUCUCCUCAGACAGCGUCGAUGUCGGAAUUCGCGGGGAGGAAUACUAAACAUGCUGAAGUUGAUACAUGUACAAUUGCCGCGAACCAGGUGCACAGGGUGCCCAACGAUCCAUGUGGAACGAGAGCGAUCUAGCC