Voyager SkyGazer Software The directions for this lab assumes the Voyager SkyGazer Software is installed on your computer for this exercise. It has been done using different software, in particular apps for the iPhone. Question 12 may give you problems as some software won’t allow you to go back in time 2000 years. If your chosen software has this limitation, try a different internet package. If you are using a different software program, explain what “button” you need to push to accomplish the following tasks. We will explore the Voyager software package. It will allow you to see the “sky” change in a matter of minutes, changes that would take many years in the real sky. Our approach will be to present a problem or task that will require you to modify the program settings. You will then need to answer questions and submit them as your report. If you are faxing or mailing the report to me, you must include the coversheet so your work will be routed to me. Part 1: Setting time, direction of viewing and location. On the top menu, locate “Chart”; it is the third option from the left. Click “Chart” and a dropdown menu opens. The first option is “Set Time”; the second option is “Set Location”. Select “Set Location”. A scroll menu of locations appears on the left of the Set Location Box. Find and select San Francisco. Later, you can play with other locations. We want to be able to change the direction we are looking in Voyager’s sky. There are three ways of changing the view direction. First, on the top menu find “Center” to the right of “Chart”. Click “Center” and then chose your direction. Let’s look South. Another way is to use the slide bar at the bottom of the screen. Put the mouse pointer on the slide bar, hold down the left mouse button, and move the slider to the right. You will see a compass appear, indicating your viewing direction. Again, select South. Finally, you can put the mouse pointer on the sky, hold down the left mouse button, and simply drag the sky to where you want to look. Notice the mouse pointer changes to a hand when you move the sky. If you are looking south and see mostly “ground”, you can either move the slider at the right of the screen or, by holding the left mouse button down, drag the display to show more sky. Depending on when you are doing this exercise, you may have a day or a night sky. Let’s change the date and time by clicking the “Chart” option on the top menu and then selecting “Select Time”. Much ado was made about the world ending, according to the Mayan Calendar, on December 21st, 2012 due to a planetary alignment. Let’s see if the planets were aligned on this date. Let’s pick a time of 10:00 p.m. on December 21st, 2012. Enter this time into the Select Time Box. Remember, you need to be looking south.
Close all boxes on the screen except the “Time” box
Question 1: Were the planets aligned on December 21, 2012? If the planet labels are not shown, select “Display” on the top menu, then on the drop down select “labels” and make sure there is a check besides “planets”. If there is not a check, simply click on “planets”. An alignment means the planets appear together as a single object. They are always found on a path going west to east across the sky.
Question 2: In the sky, we can see at most 7 planets – we are standing on one of the planets, Earth, so we don’t see it in the sky! Remember, Pluto is not a planet! Let’s see where the planets are in the night sky. Not all the planets may be in the night sky. Change the viewing time to 5:00 p.m. by using the “Select Time” option. Again, you are looking south. Describe the order of the planets, Sun, and Moon on the ecliptic. The Sun is not visible but deduce where it must be.
Question 3: In the “Time” box open on the screen, change the “Step” to 5 minutes by clicking at the right of the Step row. Now click “Start”. Notice the sky changes as does the clock in the “Time” box. If you click “Stop”, you can stop the change of time. The other options in the same row as the “Start” button control the motion of the sky as well. What do the other four options in the Start row do?
Question 4: Let’s find in which constellations the Sun, Moon, and planets are. Place the mouse pointer near a planet (or Moon or Sun) and left mouse click. Another box should open, listing where the pointer is. For each object, record its constellation. To see all the objects, you will need to click on the Start and Stop buttons several times.
Question 5: During the night of December 21st, 2012, did the planets ever align?
Question 6: What is your explanation for your answer to Question 5?
Question 7: Reset the time back to 5:00 p.m. on December 21st, 2012. Using a step time of 5 minutes (you should not need to change this), click on “Start” in the Time Box. Describe the movement of the stars over the course of the night.
Question 8: It is said the stars rise in the east and set in the west. Discuss this statement using your observations for Question 7. Change the cardinal points (north/south/east/west).
Question 9: Now change your viewing time to 4:00 a.m. and your viewing direction to east. Leaving the step time at 5 minutes, click on “Start” in the Time Box. Click on “Stop” when you see the Sun rise. At what time did the Sun rise?
Question 10: By moving the slider at the bottom of the screen, center the Sun on the screen so it is half way between the left side of the screen and the right side. With the mouse button held down on the slider, note the direction indicated by the compass. Does the Sun always rise in the east? Justify your answer. Make large changes in the date before committing to your answer.
Question 11: Now change the Time Step to “1 day” by clicking at the right side of the Step row in the Time Box. Click the “Start” and observe the Sun for a year (by program time!). Describe the movement of the Sun.
Question 12: Look at these websites – http://www.versebyverse.org/doctrine/birthofchrist.html. http://www.themoorings.org/apologetics/chronology/Chrmas.html http://www.msnbc.msn.com/id/3077385/
By changing the location to Mideast and then Jersalem, you can investigate each of these articles in terms of the astronomy impact on the stories. You will need to make a major time change – over 2000 years! Does your investigation support or contradict the articles? I am not referring to the religious aspect of the articles; stay focused on the astronomy mentioned in the articles. Justify your response.
Question 13: Play with some of the other features (your choice!) of Voyager. Describe what you did with each action and how it changed the display. What did you learn with your selfdirected investigation?
In: Computer Science
Union Brake Inc.’s comparative balance sheet information at December 31, 2017 and 2016, and its income statement for the year ended December 31, 2017, are as follows: Union Brake Inc. Income Statement For Year Ended December 31, 2017 Sales $ 877,000 Cost of goods sold 572,000 Gross profit $ 305,000 Operating expenses $ 132,680 Depreciation expense 41,240 173,920 Operating Profit 131,080 Loss on sale of equipment 11,580 Investment income 18,520 Profit before taxes 138,020 Income taxes 16,000 Profit 122,020 Union Brake Inc. Balance Sheet Information December 31 2017 2016 Net Change Cash $ 44,000 $ 24,160 $ 19,840 Cash equivalents 24,280 8,800 15,480 Accounts receivable 87,520 33,440 54,080 Inventory 113,440 79,520 33,920 Investment 0 24,280 (24,280) Land 76,000 76,000 0 Building and equipment 423,240 441,760 (18,520) Accumulated depreciation 114,080 92,960 21,120 Accounts payable 12,480 37,000 (24,520) Dividends payable 1,600 1,000 600 Bonds payable 20,000 0 20,000 Preferred shares 80,800 80,800 0 Common shares 405,280 405,280 0 Retained earnings 134,240 70,920 63,320 During 2017, the following transactions occurred: 1. Purchased equipment for $20,600 cash. 2. Sold the long-term investment on January 1, 2017 for $42,800, resulting in investment income of 18,520. 3. Sold equipment for $7,420 cash that had originally cost $39,120 and had $20,120 of accumulated depreciation. 4. Issued $20,000 of bonds payable at face value. Required: 1. How much cash was paid in dividends? 2. Prepare a statement of cash flows for Union Brake for the year ended December 31, 2017, using the indirect method. (List any deduction in cash and cash outflows as negative amounts.)
In: Accounting
In formal terms, a monitor is an object which only allows one of its methods to be executed at once.
For Java:
1) How could you implement a class satisfying the monitor’s fundamental mutual exclusion property – that is, a class whose instantiated objects ensured mutual exclusion among their methods? Provide a code fragment as an example.
2) Could you mutually exclude critical sections smaller than an entire method without resorting to mutex locks? If so, how?
3) How would you implement condition variables as we described them in class? Provide a code fragment as an example.
4) Does the implementation differ if you need more than one condition variable? If so, how?
In: Computer Science
Question 1: William Comanor and Thomas Wilson1 specified the following regression in their study of advertising’s effect on the profit rates of 41 consumer goods firms: PRi = β0 + β1 ×ADVi/SALESi + β2 ×lnCAPi + β3 ×lnESi + β4 ×lnDGi + i where: PRi = the profit margin of the ith firm ADVi = the advertising expenditures in the ith firm (in dollars) SALESi = the total gross sales of the ith firm (in dollars) CAPi = the capital needed to enter the ith firm’s market at an efficient size ESi = the degree to which economies of scale exist in the ith firm’s industry DGi = percent growth in sales (demand) of the ith firm over the last 10 years a) Hypothesize expected signs for each of the slope coefficients. b) Note that there are two different kinds of nonlinear (in the variables) relationships in this equation. For each independent variable, determine the shape that the chosen functional form implies, and state whether you agree or disagree with this shape. Explain your reasoning in each case. c) Comanor and Wilson state that the simple correlation coefficient between ADVi/SALESi and each of the other independent variables is positive. If one of these other variables were omitted, in which direction would ˆ β1 likely be biased? Refer to your hypothesized signs of the coefficients in part (a).
In: Math
The heart and circulatory system in vertebrates has changed significantly compared to the two-chambered heart of our fish ancestors. Describe the major changes in the general structure of the vertebrate heart starting with fish to amphibians to mammals and birds. Be sure to explain the evolutionary significance of these changes. For example, explain how changes in the heart have allowed mammals to grow large and both birds and mammals to be more active.
In: Biology
Geary Machine Shop is considering a four-year project to improve its production efficiency. Buying a new machine press for $720,000 is estimated to result in $240,000 in annual pretax cost savings. The press falls in the MACRS five-year class (MACRS Table), and it will have a salvage value at the end of the project of $105,000. The press also requires an initial investment in spare parts inventory of $30,000, along with an additional $4,500 in inventory for each succeeding year of the project. Required : If the shop's tax rate is 35 percent and its discount rate is 16 percent, what is the NPV for this project? (Do not round your intermediate calculations.) rev: 09_18_2012 $-106,139.92 $-103,318.84 $-170,365.41 $-111,446.91 $-100,832.92
In: Finance
How do I convert 29.35 W to J/sec?
How do I convert 312 ft3s-1mi-2 to m3 min.-1km-2?
How do I convert from 2.2 km/hr to ft sec-1 and mi2 hr-1?
How do I convert from 5.4 ft sec-1 to cm sec-1 and m hr-1?
In: Physics
Matlab: When I plot "figure (3)", I would like it to produce three lines/curves instead of data points. Currently, the code will only produce a plot when I use characters and symbols. Please help...
%-------------------------------------------------------------------------------------------------------------%
clear all
close all
clc
xmax=1;
ne=100;
nx=ne+1;
dx=xmax/ne;
dxdx=dx+dx;
dx2=dx*dx;
dt=0.02;
%-------------------------------------------------------------------------------------------------------------%
for i=1:nx
u(i)=0;
bvec(i)=0;
end
u=u';
bvec=bvec';
amat(1,1)=1;
for i=2:nx-1
amat(i,i)=(2/dx2)+(1/dt);
amat(i,i-1)=-(1/dx2);
amat(i,i+1)=-(1/dx2);
end
amat(nx,nx)=1;
av=inv(amat);
for it=1:100
zt(it)=(it-1)*dt;
bvec(1)=-exp(-(zt(it)-0.5)^2/0.03);
for j=2:nx-1
bvect(j)=(u(j)/dt)+(1/2*u(j));
end
bvec(nx)=zt(it)*(sin(4*zt(it)))^4;
u=av*bvec;
for j=1:nx
out(it,j)=u(j);
end
end
%-------------------------------------------------------------------------------------------------------------%
figure(1)
mesh(out)
xlabel('X')
ylabel('Time')
zlabel('Temperature')
title('Temperature as a Function of Time and Space')
%-------------------------------------------------------------------------------------------------------------%
figure(2)
pcolor(out)
xlabel('X')
ylabel('Time')
title('Temperature as a Function of Time and Space')
%-------------------------------------------------------------------------------------------------------------%
figure(3)
for k=1:ne
plot(zt(k),out(k,1),'r*')
hold on
plot(zt(k),out(k,31),'b*')
hold on
plot(zt(k),out(k,61),'g*')
hold on
end
title('Time History of Temperature at Different Locations')
xlabel('Time')
ylabel('Temperature')
legend('x=0.0','x=0.3','x=0.6')
In: Computer Science
1.) An old vial of radioactivee material was found buried in the ground at Hanford Site. in 2014, it was found to contain 0.1578 Ci of 238Pu and 0.1125 Ci of 234U. the vial was labebled year 1951. how many atoms of 238 Pu and 234U were present in the vial in 1951 ?
238 94U a (t1/2)=87.72 y -> 23492U a (t1/2)=2.455*10^5 y ->23090TTh
In: Chemistry
C++ program, include comments stating what each part of code does please. I want to be able to understand it so I'll be more knowledgeable in the future. The program is multiple files(transcribe_dna_to_rna.h file, transcribe_dna_to_rna.cpp file, main.cpp file and loops_strings_test.cpp). After the directions I also included any starter code or comments left by my professor within the files to aide us.
Directions:
In folder 05_loops_strings write prototype and definition for string value - return function transcribe_dna_into_rna with a string parameter that returns the rna string. Write the required unit test(s) in folder 05_loops_strings_test. Main program flow: No loop. Use the given string as function argument call transcribe_dna_into_rna function and display the output.
transcribe_dna_to_rna.h
| /* | |
| Create a function transcribe_dna_into_rna with a dna const reference string parameter that returns a string. | |
| */ |
transcribe_dna_to_rna.cpp
| //Write include statements | |
| /* | |
| An RNA string is a string formed from the alphabet containing 'A', 'C', 'G', and 'U'. | |
| Given a DNA string t corresponding to a coding strand, its transcribed RNA string u is formed by replacing | |
| all occurrences of 'T' in t with 'U' in u. | |
| Given: A DNA string | |
| Return: The transcribed RNA string of the DNA string | |
| Examle: | |
| dna_string: GATGGAACTTGACTACGTAAATT | |
| transcribe_dna_into_rna("GATGGAACTTGACTACGTAAATT"); | |
| returns: | |
| GAUGGAACUUGACUACGUAAAUU | |
| */ |
main.cpp
| //Write include statements | |
| //Write using statements | |
| /* | |
| No loop. | |
| Use the string "GATGGAACTTGACTACGTAAATT" call the transcribe_dna_into_rna function and display the result | |
| */ | |
| int main() | |
| { | |
| return 0; | |
| } |
loops_strings_test.cpp
| #define CATCH_CONFIG_MAIN // This tells Catch to provide a main() - only do this in one cpp file | |
| #include "catch.hpp" | |
| //Write include statements | |
| /* | |
| Write test case for transcribe dna to rna with string: | |
| "GATGGAACTTGACTACGTAAATT" returns GAUGGAACUUGACUACGUAAAUU | |
| */ |
In: Computer Science
data information
NAME: Hat measurements, including hat size
TYPE: Observational
SIZE: 26 observations, 6 variables
DESCRIPTIVE ABSTRACT:
The dataset contains hat size as well as circumference, length of major axis
and length of minor axis of the inner hat band for 26 hats. The manufacturer
and the country of manufacture are also included.
SOURCE:
Katherine Brady and Kari Cornelius, Carleton College ('96) students, gathered
the observations from hats at a store at the Mall of America in Bloomington,
Minnesota.
VARIABLE DESCRIPTIONS:
Variables
1 Hat size
2 Circumference (inches)
3 Length of major axis (inches)
4 Length of minor axis (inches)
5 Where made? Italy = 1, U.S.A. = 2
6 Manufacturer? Beaver = 1, Borsalino = 2, Dobbs = 3, Stetson = 4
please answer the follow question
How many variables are there, and how are they defifined?
• Which variables are quantitative and which are categorical?
• What are the units of measurement for each quantitative variable?
• What questions do you plan to investigate in your project? These may be questions that were of interest
to the researchers who collected data, or they may be questions that you thought of yourself. Make sure to
include questions that you can hope to answer using methods from this course.
In: Math
The expected pretax return on three stocks is divided between dividends and capital gains in the following way:
|
Stock |
Expected Dividend |
Expected Capital Gain |
|
A |
$0 |
$10 |
|
B |
5 |
5 |
|
c |
10 |
0 |
a. If each stock is priced at $190, what are the expected net percentage returns on each stock to (i) a pension fund that does not pay taxes, (ii) a corporation paying tax at 21% (the effective tax rate on dividends received by corporations is 6.3%), and (iii) an individual with an effective tax rate of 15% on dividends and 10% on capital gains?
b. Suppose that investors pay 50% tax on dividends and 20% tax on capital gains. If stocks are priced to yield an after-tax return of 8%, what would A, B, and C each sell for? Assume the expected dividend is a level perpetuity.
If each stock is priced at $190, what are the expected net percentage returns on each stock to (i) a pension fund that does not pay taxes, (ii) a corporation paying tax at 21% (the effective tax rate on dividends received by corporations is 6.3%), and (iii) an individual with an effective tax rate of 15% on dividends and 10% on capital gains? (Do not round intermediate calculations. Enter your answers as a percent rounded to 2 decimal places.)
|
Stock |
Pension |
Investor Corporation |
Individual |
|
A |
% |
% |
% |
|
B |
% |
% |
% |
|
C |
% |
% |
% |
Suppose that investors pay 50% tax on dividends and 20% tax on capital gains. If stocks are priced to yield an after-tax return of 8%, what would A, B, and C each sell for? Assume the expected dividend is a level perpetuity. (Do not round intermediate calculations. Round your answers to 2 decimal places.)
|
Stock |
Price |
|
A |
$ |
|
B |
$ |
|
C |
$ |
In: Finance
Importance of Accounting and international business
Write a 250 words post explaining why having an international accounting overview is important. Provide examples.
In: Accounting
The following costs result from the production and sale of 4,550
drum sets manufactured by Tight Drums Company for the year ended
December 31, 2019. The drum sets sell for $305 each. The company
has a 40% income tax rate.
| Variable production costs | |||
| Plastic for casing | $ | 127,400 | |
| Wages of assembly workers | 423,150 | ||
| Drum stands | 168,350 | ||
| Variable selling costs | |||
| Sales commissions | 118,300 | ||
| Fixed manufacturing costs | |||
| Taxes on factory | 9,500 | ||
| Factory maintenance | 19,000 | ||
| Factory machinery depreciation | 79,000 | ||
| Fixed selling and administrative costs | |||
| Lease of equipment for sales staff | 19,000 | ||
| Accounting staff salaries | 69,000 | ||
| Administrative management salaries | 149,000 | ||
Required:
1. Prepare a contribution margin income statement
for the year.
2. Compute its contribution margin per unit and
its contribution margin ratio.
3. For each dollar of sales, how much is left to
cover fixed costs and contribute to operating income?
In: Accounting
If ?H = -60.0kJ and ?S = -0.300kJ/K , the reaction is spontaneous below a certain temperature. Calculate that temperature.
In: Chemistry