The heart and circulatory system in vertebrates has changed significantly compared to the two-chambered heart of our fish ancestors. Describe the major changes in the general structure of the vertebrate heart starting with fish to amphibians to mammals and birds. Be sure to explain the evolutionary significance of these changes. For example, explain how changes in the heart have allowed mammals to grow large and both birds and mammals to be more active.
In: Biology
Geary Machine Shop is considering a four-year project to improve its production efficiency. Buying a new machine press for $720,000 is estimated to result in $240,000 in annual pretax cost savings. The press falls in the MACRS five-year class (MACRS Table), and it will have a salvage value at the end of the project of $105,000. The press also requires an initial investment in spare parts inventory of $30,000, along with an additional $4,500 in inventory for each succeeding year of the project. Required : If the shop's tax rate is 35 percent and its discount rate is 16 percent, what is the NPV for this project? (Do not round your intermediate calculations.) rev: 09_18_2012 $-106,139.92 $-103,318.84 $-170,365.41 $-111,446.91 $-100,832.92
In: Finance
How do I convert 29.35 W to J/sec?
How do I convert 312 ft3s-1mi-2 to m3 min.-1km-2?
How do I convert from 2.2 km/hr to ft sec-1 and mi2 hr-1?
How do I convert from 5.4 ft sec-1 to cm sec-1 and m hr-1?
In: Physics
Matlab: When I plot "figure (3)", I would like it to produce three lines/curves instead of data points. Currently, the code will only produce a plot when I use characters and symbols. Please help...
%-------------------------------------------------------------------------------------------------------------%
clear all
close all
clc
xmax=1;
ne=100;
nx=ne+1;
dx=xmax/ne;
dxdx=dx+dx;
dx2=dx*dx;
dt=0.02;
%-------------------------------------------------------------------------------------------------------------%
for i=1:nx
u(i)=0;
bvec(i)=0;
end
u=u';
bvec=bvec';
amat(1,1)=1;
for i=2:nx-1
amat(i,i)=(2/dx2)+(1/dt);
amat(i,i-1)=-(1/dx2);
amat(i,i+1)=-(1/dx2);
end
amat(nx,nx)=1;
av=inv(amat);
for it=1:100
zt(it)=(it-1)*dt;
bvec(1)=-exp(-(zt(it)-0.5)^2/0.03);
for j=2:nx-1
bvect(j)=(u(j)/dt)+(1/2*u(j));
end
bvec(nx)=zt(it)*(sin(4*zt(it)))^4;
u=av*bvec;
for j=1:nx
out(it,j)=u(j);
end
end
%-------------------------------------------------------------------------------------------------------------%
figure(1)
mesh(out)
xlabel('X')
ylabel('Time')
zlabel('Temperature')
title('Temperature as a Function of Time and Space')
%-------------------------------------------------------------------------------------------------------------%
figure(2)
pcolor(out)
xlabel('X')
ylabel('Time')
title('Temperature as a Function of Time and Space')
%-------------------------------------------------------------------------------------------------------------%
figure(3)
for k=1:ne
plot(zt(k),out(k,1),'r*')
hold on
plot(zt(k),out(k,31),'b*')
hold on
plot(zt(k),out(k,61),'g*')
hold on
end
title('Time History of Temperature at Different Locations')
xlabel('Time')
ylabel('Temperature')
legend('x=0.0','x=0.3','x=0.6')
In: Computer Science
1.) An old vial of radioactivee material was found buried in the ground at Hanford Site. in 2014, it was found to contain 0.1578 Ci of 238Pu and 0.1125 Ci of 234U. the vial was labebled year 1951. how many atoms of 238 Pu and 234U were present in the vial in 1951 ?
238 94U a (t1/2)=87.72 y -> 23492U a (t1/2)=2.455*10^5 y ->23090TTh
In: Chemistry
C++ program, include comments stating what each part of code does please. I want to be able to understand it so I'll be more knowledgeable in the future. The program is multiple files(transcribe_dna_to_rna.h file, transcribe_dna_to_rna.cpp file, main.cpp file and loops_strings_test.cpp). After the directions I also included any starter code or comments left by my professor within the files to aide us.
Directions:
In folder 05_loops_strings write prototype and definition for string value - return function transcribe_dna_into_rna with a string parameter that returns the rna string. Write the required unit test(s) in folder 05_loops_strings_test. Main program flow: No loop. Use the given string as function argument call transcribe_dna_into_rna function and display the output.
transcribe_dna_to_rna.h
| /* | |
| Create a function transcribe_dna_into_rna with a dna const reference string parameter that returns a string. | |
| */ |
transcribe_dna_to_rna.cpp
| //Write include statements | |
| /* | |
| An RNA string is a string formed from the alphabet containing 'A', 'C', 'G', and 'U'. | |
| Given a DNA string t corresponding to a coding strand, its transcribed RNA string u is formed by replacing | |
| all occurrences of 'T' in t with 'U' in u. | |
| Given: A DNA string | |
| Return: The transcribed RNA string of the DNA string | |
| Examle: | |
| dna_string: GATGGAACTTGACTACGTAAATT | |
| transcribe_dna_into_rna("GATGGAACTTGACTACGTAAATT"); | |
| returns: | |
| GAUGGAACUUGACUACGUAAAUU | |
| */ |
main.cpp
| //Write include statements | |
| //Write using statements | |
| /* | |
| No loop. | |
| Use the string "GATGGAACTTGACTACGTAAATT" call the transcribe_dna_into_rna function and display the result | |
| */ | |
| int main() | |
| { | |
| return 0; | |
| } |
loops_strings_test.cpp
| #define CATCH_CONFIG_MAIN // This tells Catch to provide a main() - only do this in one cpp file | |
| #include "catch.hpp" | |
| //Write include statements | |
| /* | |
| Write test case for transcribe dna to rna with string: | |
| "GATGGAACTTGACTACGTAAATT" returns GAUGGAACUUGACUACGUAAAUU | |
| */ |
In: Computer Science
data information
NAME: Hat measurements, including hat size
TYPE: Observational
SIZE: 26 observations, 6 variables
DESCRIPTIVE ABSTRACT:
The dataset contains hat size as well as circumference, length of major axis
and length of minor axis of the inner hat band for 26 hats. The manufacturer
and the country of manufacture are also included.
SOURCE:
Katherine Brady and Kari Cornelius, Carleton College ('96) students, gathered
the observations from hats at a store at the Mall of America in Bloomington,
Minnesota.
VARIABLE DESCRIPTIONS:
Variables
1 Hat size
2 Circumference (inches)
3 Length of major axis (inches)
4 Length of minor axis (inches)
5 Where made? Italy = 1, U.S.A. = 2
6 Manufacturer? Beaver = 1, Borsalino = 2, Dobbs = 3, Stetson = 4
please answer the follow question
How many variables are there, and how are they defifined?
• Which variables are quantitative and which are categorical?
• What are the units of measurement for each quantitative variable?
• What questions do you plan to investigate in your project? These may be questions that were of interest
to the researchers who collected data, or they may be questions that you thought of yourself. Make sure to
include questions that you can hope to answer using methods from this course.
In: Math
The expected pretax return on three stocks is divided between dividends and capital gains in the following way:
|
Stock |
Expected Dividend |
Expected Capital Gain |
|
A |
$0 |
$10 |
|
B |
5 |
5 |
|
c |
10 |
0 |
a. If each stock is priced at $190, what are the expected net percentage returns on each stock to (i) a pension fund that does not pay taxes, (ii) a corporation paying tax at 21% (the effective tax rate on dividends received by corporations is 6.3%), and (iii) an individual with an effective tax rate of 15% on dividends and 10% on capital gains?
b. Suppose that investors pay 50% tax on dividends and 20% tax on capital gains. If stocks are priced to yield an after-tax return of 8%, what would A, B, and C each sell for? Assume the expected dividend is a level perpetuity.
If each stock is priced at $190, what are the expected net percentage returns on each stock to (i) a pension fund that does not pay taxes, (ii) a corporation paying tax at 21% (the effective tax rate on dividends received by corporations is 6.3%), and (iii) an individual with an effective tax rate of 15% on dividends and 10% on capital gains? (Do not round intermediate calculations. Enter your answers as a percent rounded to 2 decimal places.)
|
Stock |
Pension |
Investor Corporation |
Individual |
|
A |
% |
% |
% |
|
B |
% |
% |
% |
|
C |
% |
% |
% |
Suppose that investors pay 50% tax on dividends and 20% tax on capital gains. If stocks are priced to yield an after-tax return of 8%, what would A, B, and C each sell for? Assume the expected dividend is a level perpetuity. (Do not round intermediate calculations. Round your answers to 2 decimal places.)
|
Stock |
Price |
|
A |
$ |
|
B |
$ |
|
C |
$ |
In: Finance
Importance of Accounting and international business
Write a 250 words post explaining why having an international accounting overview is important. Provide examples.
In: Accounting
The following costs result from the production and sale of 4,550
drum sets manufactured by Tight Drums Company for the year ended
December 31, 2019. The drum sets sell for $305 each. The company
has a 40% income tax rate.
| Variable production costs | |||
| Plastic for casing | $ | 127,400 | |
| Wages of assembly workers | 423,150 | ||
| Drum stands | 168,350 | ||
| Variable selling costs | |||
| Sales commissions | 118,300 | ||
| Fixed manufacturing costs | |||
| Taxes on factory | 9,500 | ||
| Factory maintenance | 19,000 | ||
| Factory machinery depreciation | 79,000 | ||
| Fixed selling and administrative costs | |||
| Lease of equipment for sales staff | 19,000 | ||
| Accounting staff salaries | 69,000 | ||
| Administrative management salaries | 149,000 | ||
Required:
1. Prepare a contribution margin income statement
for the year.
2. Compute its contribution margin per unit and
its contribution margin ratio.
3. For each dollar of sales, how much is left to
cover fixed costs and contribute to operating income?
In: Accounting
If ?H = -60.0kJ and ?S = -0.300kJ/K , the reaction is spontaneous below a certain temperature. Calculate that temperature.
In: Chemistry
Consider this scenario: You own a small business with 25 employees. In your initial post, explain which internal controls you would use to protect your assets and ensure that your financial statements are accurate.
In: Accounting
|
What sort of records should be kept according the Taxation Administration Act 2005? How long must these records be kept for? ( Approximate Word Count 20) |
In: Accounting
At a certain temperature, this reaction establishes an equilibrium with the given equilibrium constant, Kc.
3A(g)+2B(g)−⇀↽−4C(g)Kc=2.53×1031
If, at this temperature, 1.70 mol of A and 3.50 mol of B are placed in a 1.00 L container, what are the concentrations of A, B, and C at equilibrium?
[A]=
[B]=
[C]=
In: Chemistry
Define a class named Payment that contains an instance variable "paymentAmount" (non-static member variable) of type double that stores the amount of the payment and appropriate accessor (getPaymentAmount() ) and mutator methods. Also create a method named paymentDetails that outputs an English sentence to describe the amount of the payment. Override toString() method to call the paymentDetails() method to print the contents of payment amount and any other details not included in paymentDetails().
Define a class named CashPayment that is derived from Payment. This class will have an additional instance variable of type String (a non-static member variable) that specifies a type of currency, such as "dollar", "euro", "peso", "yen", etc. This class should override the paymentDetails method to indicate that the payment is in cash, and the type of currency used. Include appropriate constructor(s) and accessor/mutator methods for all instance variablesand. Override toString() with contents of cash payment details (should still call paymentDetails()).
Hello folks, i need some JAVA help here.
Define a class named CreditCardPayment that is derived from Payment. This class should contain instance variables (member variables) for the name on the card, expiration date, and credit card number. Include appropriate constructor(s) and accessor/mutator methods for all instance variables. Finally, redefine thepaymentDetails method to include all credit card information in the printout. Override toString() method with contents of credit payment details (should still call paymentDetails()).
Create a main method within Payment that creates at least two CashPayment and two CreditCardPayment objects with different values and payment amounts. Call toString() methods from each object to print the details of each payment.
In: Computer Science