I have a one strand DNA sequence that I am trying to determine the base pairs for. The gene is CYP1A2 and the primers and sequence are below.
Below is the sequence of part of the CYP1A2 gene (you are given only 1 strand, written in the 5’ – 3’ direction).
5’TGGGCTAGGTGTAGGGGTCCTGAGTTCCGGGCTTTGCTACCCAGCTCTTGACTTCTGTTTCCCGATTTTA
AATGAGCAGTTTGGACTAAGCCATTTTTAAGGAGAGCGATGGGGAGGGCTTCCCCCTTAGCACAAGGGCA
GCCCTGGCCCTGGCTGAAGCCCAACCCCAACCTCCAAGACTGTGAGAGGATGGGGACTCATCCCTGGAGG
AGGTGCCCCTCCTGGTATTGATAAAGAATGCCCTGGGGAGGGGGCATCACAGGCTATTTGAACCAGCCCT
GGGACCTTGGCCACCTCAGTGTCACTGGGTAGGGGGAACTCCTGGTCCCTTGGGTATATGGAAGGTATCA
GCAGAAAGCCAGCACTGGCAGGGACTCTTTGGTACAATACCCAGCATGCATGCTGTGCCAGGGGCTGACA
AGGGTGCTGTCCTTGGCTTCCCCATTTTGGAGTGGTCACTTGCCTCTACTCCAGCCCCAGAAGTGGAAAC
TGAGATGATGTGTGGAGGAGAGAGCCAGCGTTCATGTTGGGAATCTTGAGGCTCCTTTCCAGCTCTCAGA
TTCTGTGATGCTCAAAGGGTGAGCTCTGTGGGCCCAGGACGCATGGTAGATGGAGCTTAGTCTTTCTGGT
ATCCAGCTGGGAGCCAAGCACAGAACACGCATCAGTGTTTATCAAATGACTGAGGAAATGAATGAATGAA
TGTCTCCATCTCAACCCTCAGCCTGGTCCCTCCTTTTTTCCCTGCAGTTGGTACAGATGGCATTGTCCCA
GTCTGTTCCCTTCTCGGCCACAGAGCTTCTCCTGGCCTCTGCCATCTTCTGCCTGGTATTCTGGGTGCTC
AAGGGTTTGAGGCCTCGGGTCCCCAAAGGCCTGAAAAGTCCACCAGAGCCATGGGGCTGGCCCTTGCTCG
GGCATGTGCTGACCCTGGGGAAGAACCCGCACCTGGCACTGTCAAGGATGAGCCAGCGCTACGGGGACGT
CCTGCAGATCCGCATTGGCTCCACGCCCGTGCTGGTGCTGAGCCGCCTGGACACCATCCGGCAGGCCCTG 3’
The sequences of the primers used to amplify part of the CYP1A2 gene are as follows:
Forward primer: 5’ GAGAGCGATGGGGAGGGC 3’
Reverse primer: 5’ CCCTTGAGCACCCAGAATACC 3’
The restriction enzyme ApaI recognises and cleaves the sequence GGGCC^C (^ indicates where the DNA is cleaved).
I need to determine the fragment sizes for the alleles AA, AC and CC. I believe I have worked out AA (766bp) and CC as (507bp + 259bp), but am stuck on AC
In: Biology
Table 3: Temperature Effects on Catalase (pg 251 in lab manual):
|
Time (sec) |
Tubes 2 & 3 00C |
Tubes 4 & 5 220C |
Tubes 6 & 7 370C |
Tubes 8 & 9 480C |
Tubes 10 & 11 1000C |
|
20 |
0.096 |
0.136 |
0.137 |
0.124 |
0 |
|
40 |
0.164 |
0.206 |
0.245 |
0.226 |
0 |
|
60 |
0.226 |
0.275 |
0.339 |
0.313 |
0 |
|
80 |
0.284 |
0.337 |
0.413 |
0.379 |
0 |
|
100 |
0.335 |
0.38 |
0.466 |
0.452 |
0 |
|
120 |
0.378 |
0.412 |
0.495 |
0.497 |
0 |
Follow the same procedure described for enzyme availability to plot the five data series on the same graph (again, scatter plot). Record the reaction rates in table 4 below.
In: Biology
Choose all the true statements.
-Liquid water has a lower entropy than liquid benzene at 25°C because of hydrogen bonding in water.
-Entropy is the main driving force in the formation of the DNA double helix.
-All elements in their standard states have an entropy of zero at 25°C.
-Reactions that involve only gases always have a positive change in entropy
-Evaporating a liquid has always a positive change in entropy freezing water is possible only if the entropy of the surroundings increases
-It is impossible to freeze ethanol because the change in entropy of the system is negative.
-Ice at 0°C has a higher entropy than liquid water at 0°C because the density of ice is lower than the density of water.
-Binding a substrate to an enzyme always lowers the entropy because the substrate loses translational and rotational degrees of freedom.
In: Chemistry
1.
How do heavy metals such as arsenite inhibit the PDC?
Group of answer choices
They complex with FAD
They complex with pyruvate dehydrogenase
They complex with Acetyl CoA
They complex with lipoic acid
2.
Glucose can NOT be synthesized from which of the following organic molecules?
Group of answer choices
Pyruvate
Alanine
Glycerol
Adenine
Lactate
3.
Which of the following vitamins are precursors to coenzymes that are necessary for the formation of succinyl CoA from α-ketoglutarate?
Group of answer choices
thiamine, riboflavin, niacin, lipoic acid, pantothenic acid, and biotin
thiamine, riboflavin, niacin, and biotin
thiamine, riboflavin, niacin, lipoic acid, and pantothenic acid
thiamine, riboflavin, and lipoic acid
4.
The bifunctional enzyme is also known as __________.
Group of answer choices
phosphoenolpyruvate carboxy kinase
phosphofructokinase II
protein kinase 2
phosphofructokinase I
fructose 1-6 phosphatase
In: Biology
A cause of macrocytic anemia is:
A. Iron deficiency
B. Antibodies against intrinsic factor
C. An enzyme deficiency
D. Inheritance of abnormal hemoglobin structure
E. None of the above
2. In sickle cell disease, vassoocclusive crisis is the result of:
A. Sequestration of large number of RBCs in the Spleen
B. Damage to the platelets due to antibodies
C. plugging of small blood vessels by sickle RBCs
D. Treatment Drugs side effects
3. Localized out pouching of heart chamber is a /an:
A. Thrombus
B. Embolus
C. Aneurysm
D. Thromboembolism
4. Which of the following is not a risk factor in development of atherosclerosis?
A. Diabetes
B. Smoking
C. Hypertension
D. Anemia
5. The current anabolic steroids used by some gym rats are LEAST LIKELY to give them:
In: Biology
topic- how food travels through the body
I would like to know how a salad, French fries or concentrated sweets are digested. If you were teaching a basic lesson on digestion, how would you describe the digestive process and what does the body do if eating salad or French fries, is there a difference? where hormones and enzyme information begins about how the activities vary depending on the food.
The goal is to understand what happens to the food when the body digests it and how does the body respond. This entire assignment should just be a couple of paragraphs, concise description is what I'm looking for.
(To help you out as an example, when you eat fat the gallbladder secretes bile made by the liver but if you eat an apple that doesn't happen. This will allow you to understand how digestion works.)
In: Biology
In the bacterium Bacillus subtilus, there are five genes coding for proline biosynthetic enzymes. They are located adjacent to one another on the chromosome. If excess proline is present in the medium, the synthesis of all five enzymes is coordinately repressed, whereas in the absence of proline, all five genes are coordinately expressed.
a. Most mutations in this region of the chromosome result in the loss of activity of only one of the enzymes. Explain how such a mutation would only effect the production of one enzyme. What is the counterpart of this type of mutation in the lac operon system?
b. Some mutations, mapping to one end of the cluster of proline biosynthesis genes, result in the loss of all five enzymes, even though none of the structural genes have been lost. Explain how such a mutation could affect all five genes. What is the counterpart of this type of mutation in the lac operon system?
In: Biology
Match each term below with its definition:
|
a. Programmed cell death; it’s why you don’t have webbed fingers and toes. |
|
|
b. This protein can stop the cell cycle and initiate DNA repair if necessary. |
|
|
c. Once the cell passes this, it is committed to start preparations for cell division. |
|
|
d. Causes cells to stop dividing when they come in close contact with other cells. |
|
|
e. An epidermal version helps repair damage in the skin. |
|
|
____ 6. cyclin |
f. A cap on the end of a chromosome that shortens as a cell ages. |
|
____ 7. kinase |
g. Occurs after metaphase, to make sure the chromosomes are attached to the spindle. |
|
____ 8. growth factor |
h. An enzyme needed for the cell cycle to continue. |
|
____ 9. hormone |
i. A protein whose levels increase and decrease throughout the cell cycle. |
|
____ 10. telomere |
j. A chemical such as estrogen that can signal cells to divide. |
In: Biology
Mr. K. will be beginning therapy for human immunodeficiency virus (HIV).
What type of drugs may be prescribed and why?
What would you teach the patient about these drugs and what would be some adverse effects of these drugs you would need to make the patient aware about?
In: Nursing
(a) Domesticated animals and plants can spread easily to new locations with a similar climate. The African and Eurasian continents are connected, and the climate in the south of Africa is very similar with the Eurasia continents. But why the domesticated species did not reach the south of Africa in the early human history? Explain. (3 Points)
In: Economics