5. The KEGG and NCBI databases contain a wealth of information obtained from sequencing and analyzing the complete genome of Acinetobacter baumannii 1656-2, which is a medically important oxidase negative (cytochrome c oxidase- negative) bacterium that is multidrug resistant. For this microorganism, which statement regarding oxidative phosphorylation is correct?

This microbe possesses subunits of cytochrome c oxidase and therefore displays cytochrome c oxidase activity

The formation of ATP depends directly on the oxidation of cytochrome c.

The cytochrome bd complex allows oxygen to be reduced by the quinone pool

Subunit a of the F-type ATPase has 876 amino acids

1) The following DNA strand is a template strand of a prokaryotic gene.Transcription start siteis indicated by a bold “G”.

a) Underline the promoter region of this gene by a dotted line.

b)Underscore the Pribnow box in the promoter region. What is the function of the Pribnow box?

c) Deduce the nucleotide sequence of mRNA for this gene.

d) Underscore the leader sequence in mRNA and box the initiation codon. How many amino

acids does this mRNA code for? What is the sequence of the codons in this mRNA?

e) Show 5’ and 3’ ends of the template strand and mRNA.

f) What are the -10 and +10 base pairs of this gene?

CCCTCCGTCGCTATAATGAAGTCGGAGACGGATGTACCGCGGATAA

Match the term with the best definition

Question 2 options:

Fructose 2,6-bisphosphate has what effects on glycolysis and gluconeogenesis?

BACKGROUND INFORMATION:

Vinnie is a professional road cyclist participating in the 2020 Giro d’Italia, a three-week race nearly 3,600 km in distance with some stages exceeding altitudes of 2,700 m above sea level (i.e., Stelvio Pass, Italy). As the newly hired head of the high-performance team, it is your responsibility to manage his preparation for the event. You must demonstrate to your team a fundamental understanding of physiology, the chronic adaptations expected from his training, and methods that could be implemented to improve the likelihood of success.

QUESTION:

The longest leg of the race is 228 km, during which energy intake is critical. Glycolysis and β-oxidation are processes that break down carbohydrates (i.e., glucose, sucrose, fructose) and fatty acids, respectively.

A. Individually, what is the total ATP yield from one molecule of glucose and one molecule of palmitate?

B. How did you reach these numbers (i.e., substrate yield and use)?

C. Based on what you know about the yield and speed of these two pathways, do you recommend Vinnie ingest glucose or fatty acids during the race? (Hint, the cross-over concept)

The novel coronavirus, SARS-Cov2, which is responsible for the disease Covid-19 is a positive strand RNA ((+)ssRNA) virus. From what you learned in BIOL1020, suggest a model of how the SARS-Cov2 genome is replicated. The key enzyme for viral replication is unique to the virus and not found in the human host. What is the name of the enzyme, what is its enzymatic function, and how would you explain that a drug called Remdesivir (an adenosine analogue that causes premature termination of RNA synthesis) is currently the most promising drug against a range of RNA viruses, including Ebola ((-)ssRNA virus), MERS ( (+)ssRNA virus ) and SARS-Cov2 ((+)ssRNA virus)?

Like all viral pathogens, severe acute respiratory syndrome coronavirus 2, or SARS-CoV 2 (I know, how topical), requires a cell surface receptor in order to invade a given host cell. For SARS-CoV 2, this receptor is actually the enzyme Angiotensin Converting Enzyme 2, or ACE2. ACE2 is responsible for downregulation of the Renin-Angiotensin-Aldosterone System by deactivation of Angiotensin II. Explain the RAAS in detail, including the roles played by kidneys and the lungs, and then explain what effects using recombinant human ACE2, or rhACE2, to treat acute respiratory distress syndrome could have on blood pressure.

Like all viral pathogens, severe acute respiratory syndrome coronavirus 2, or SARS-CoV 2 (I know, how topical), requires a cell surface receptor in order to invade a given host cell. For SARS-CoV 2, this receptor is actually the enzyme Angiotensin Converting Enzyme 2, or ACE2. ACE2 is responsible for downregulation of the Renin-Angiotensin-Aldosterone System by deactivation of Angiotensin II. Explain the RAAS in detail, including the roles played by kidneys and the lungs, and then explain what effects using recombinant human ACE2, or rhACE2, to treat acute respiratory distress syndrome could have on blood pressure.

Please use C++ and linked list to solve this problem

Linked list 1 -> 2 -> 3 -> 4 -> 5-> 6 ->7

replaceNode( 5 , 6) // Replace 5 with 6

    result 1 -> 2 -> 3 -> 4 -> 6 -> 6 ->7

Base code

#include <iostream>

using namespace std;

class Node {
public:
    int data;
    Node *next;

    Node(int da = 0, Node *p = NULL) {
        this->data = da;
        this->next = p;
    }
};

class LinkedList {
private:
    Node *head, *tail;
    int position;
public:
    LinkedList() { head = tail = NULL; };

    ~LinkedList() {
        delete head;
        delete tail;
    };

    void print();
    void Insert(int da = 0);

}

void LinkedList::Insert(int da) {
    if (head == NULL) {
        head = tail = new Node(da);
        head->next = NULL;
        tail->next = NULL;
    } else {
        Node *p = new Node(da);
        tail->next = p;
        tail = p;
        tail->next = NULL;

}

}

int main() {
    cout << "Hello World!" << endl;
    LinkedList l1;
    l1.Insert(1);
    l1.Insert(2;
    l1.Insert(3);
    l1.Insert(4);
    l1.Insert(5);         l1.Insert(6);

l1.Insert(7);

    l1.print();

   l1.replaceNode( 5 , 6)

   l1.print();
    cout << "The End!" << endl;
    return 0;
}

    }

}