Feminized faces in TV commercials. Television commercials most often employ females or “feminized” males to pitch a company’s product. Research published in Nature (August 27 1998) revealed that people are, in fact, more attracted to “feminized” faces, regardless of gender. In one experiment, 50 human subjects viewed both a Japanese female face and a Caucasian male face on a computer. Using special computer graphics, each subject could morph the faces (by making them more feminine or more masculine) until they attained the “most attractive” face. The level of feminization x (measured as a percentage) was measured.
a. For the Japanese female face, x = 10.2% and s = 31.3%. The researchers used this sample information to test the null hypothesis of a mean level of feminization equal to 0%. Verify that the test statistic is equal to 2.3.
b. Refer to part a. The researchers reported the p-value of the test as p = .021. Verify and interpret this result.
(I dont understand part b)
In: Statistics and Probability
Nursing Facilities and Adult Daycare
Assume you are responsible for the management and administration of the two facilities. You have to orient the newly appointed manager by providing an overview on managing long-term care. You also need to discuss the programs of the two facilities. From this perspective and based on your research about the facilities, prepare a Microsoft Word document including the following:
· What are the various multidisciplinary departments (teams) included in your facilities?
· Who comprise the target population being served by the various programs provided by your chosen facilities?
· What are the major staffing and human resource issues faced by your chosen facilities?
· What are the significant trends in long-term care likely to impact the operation of the various programs provided by your chosen facilities, and what is your plan of action to overcome them?
· What are the various forms of cooperation and integration existing in your chosen facilities? Discuss the nature of management, financing, and quality issues related to integration and cooperation in the facilities?
In: Nursing
1. Identical twins have identical copies of their brains.
true
false
2. The action of a neuron is “signal” or “no signal” due to the presence of neurotransmitters.
true
false
3. Physical and physiological differences between humans and life in other galaxies may prohibit contact.
true
false
4. The limbic system involves simple memory, including the recollection of favorable and unfavorable circumstances, allowing linkage of experiences as rudimentary “good” or “bad” feelings.
true
false
5. Within the neocortex lies the amygdala, which evaluates every situation as threatening or not.
true
false
6. Construction of human connectomes would allow detailed study of brain physiology, abilities, and behavior.
true
false
7. The mind is altered by each new event it encounters.
true
false
8. Both humans and the universe are composed of hydrogen, oxygen, carbon, and nitrogen
true
false
9. The neocortex overrides the primitive actions of the reptilian brain and limbic system, giving rise to rational thinking.
true
false
In: Biology
In class we discussed the concept of wage differentials. Historically, a correlation has existed between educational attainment and income level. Acquiring more education (human capital) has always been promoted as a means of escaping poverty. Unfortunately, due to rising college costs, students have taken on unprecedented levels of student loan debt. For this paper, you will research (with a minimum of three additional resources) the "student loan bubble" and proposed solutions to assist the impacted economic actors.
The paper should address some of these main issues:
In: Economics
How does the endocrine system regulate temperature- book example, three glands ?
What does the endocrine system use to communicate, the nervous system?
Which glands make which hormones? Major hormones
What makes up the central nervous system?
What makes up the peripheral nervous system?
Lobes of the brain-
Explain how a spinal reflex works?
Meiosis- gametogenesis – biogenesis, and spermatogenesis?
Changes that can occur to the structure of a chromosome?
The organs of the male reproductive system?
The organs of the female reproductive system?
The connection between the urinary system or lack of connection between the urinary system and reproductive system for a male or female?
The functions of the male and female reproductive system?
What is cleavage?
How many chromosomes in a sperm cell, egg cell, zygote, normal human cell?
The primary germ layers?
Zygote, morula, blastula – appearance ?
Difference between dominant and recessive alleles, heterozygous, homozygous dominant.
homozygous recessive ?
Genotype, phenotype?
Punnett square example ?
In: Biology
Write a double-spaced essay of at least 500 words on the topics listed below. Your responses should be supported by the textbook and at least 2 other references and demonstrate an understanding of the information contained in this lesson.
Your paper should be structured into a clear introduction, body, and conclusion.
List your references at the end of the paper in standard format and use In-text citations.
In: Nursing
Please answer all
1. The loss of Smad4 coupled with the loss of PTEN is not common in human cancers because both mutations lead to suppression of TGF- signals. A) True B) False
2. Tumor-promoting phorbol esters such as TPA mimic the lipid second messenger diacylglycerol. The tumor promoting effects are most likely due to the suppression of TGF signals. A) True B) False
3. EGF signals are enhanced by proton pumps that reduce the pH in endosomes carrying the endocytosed EGF receptor. A) True B) False
4. While it is widely believed that the GTPase Rheb directly activates mTORC1, the ability of PA (18:1-16:0) to activate mTORC1 in the absence of Rheb strongly suggests that it is the ability of Rheb to activate PLD that is the last step in the activation mTORC1. A) True B) False
5. PLC converts PIP2 (phosphatidylinositol-4,5-bis phosphate) to DG (diacylglycerol) and IP3 (inositol-1,4,5-trisphosphate), leading to inhibition of PLD (phospholipase D). A) True B) False
In: Biology
Short of Workers, Fast-Food Restaurants Turn to Robots
Employment opportunity in the hospitality market has never been higher. More restaurants are making efforts to deliver food and stay open later, therefore are in need of more employees. As a result, approximately 850,000 jobs in the hospitality industry are unfilled. Restaurant owners are turning to new technology to try and replace workers. For owners, it is expensive to constantly train and replace workers. In the food business, there is significant uncertainty with length of employment. Many people will take a job temporarily while they search for something with better pay. Robots would be able to eliminate this risk, but only for certain automated processes. The social aspect of having a human take your order is very important to the customer base.
1.) Other than upfront cost, what are some of the down sides associated with replacing humans with robots?
2.) What are good ways to mitigate risk when testing new technology in an unproven market?
3.) Overall, do you think the benefits outweigh the risk?
In: Finance
1) Choose a characteristic of turbulent flow below. A) Laminar flow B) Produces kinetic energy C) Viscosity dominates the flowals behavior D) The energy will always be potential energy E) Fluids moving at different rates of speed when they go through or around a solid object
2) The Lido deck is where A)there are large state rooms B) Usually where you will find the pool C) The deck below Steerage D) Where people embark
3) 100 million times better than the Human eye A) Night Goggles B) Electron Microscope C) Hubbel Telescope D) Haggis Register
4) What uses a double hull for storing ballast? A) A submarine B) An Airplane C) A Jetski D) A security safe
5) An increase in the speed of fluid implies the increase in ________________. A) Both its dynamic pressure and kinetic energy. B) Dynamic pressure, but not kinetic energy. C) Kinetic energy, but not dynamic pressure. D) None of the above.
In: Mechanical Engineering
1. ⦁ Your supervisor has asked you to desine PCR primers to amplify the following region in the human genome.
5’- CGTTCGTAATCTTGGTGAATTAATCCGATGTAGTGAAGA
GGCGGCCACTGAGCAACAGTGATTGTGTGCTGCTGTGTC
TCAGCATCAGCCGGCTTTTCCTGCATGGACTGCTGTTCC
TGAGTGCTATCCAGCTTACCCACTTCCAGAAGTTGAGTG
AACCACTGAACCACAGCTACCAAGCCATCATCATGCTAT
GGATGCTTGCATTACCAAGGCAAGCT -3’
Here is the sequence for the forward/right primer. 5’- CGTTCGTAATCTTGGTGAATTAAT-3’
a) Was this primer designed to bind the DNA strand given above or the complementary strand? Hint: you may want to write out the complementary sequence to this DNA sequence to help you answer this question.
b) Underline the bases where this primer will bind to its target sequence.
c) What is the first base that will be added by the Taq DNA polymerase that extends from this primer?
d) Assume the reverse/left primer is the same length as the forward/right primer, 24bp long.
i. What would the sequence be for this primer (indicate 3’ and 5’ ends of the primer)?
ii. Was this primer designed to bind the DNA strand given above or the complementary strand?
iii. What is the first base that will be added by the DNA polymerase that extends from this primer?
In: Biology