1. ⦁ Your supervisor has asked you to desine PCR primers to amplify the following region in the human genome.
5’- CGTTCGTAATCTTGGTGAATTAATCCGATGTAGTGAAGA
GGCGGCCACTGAGCAACAGTGATTGTGTGCTGCTGTGTC
TCAGCATCAGCCGGCTTTTCCTGCATGGACTGCTGTTCC
TGAGTGCTATCCAGCTTACCCACTTCCAGAAGTTGAGTG
AACCACTGAACCACAGCTACCAAGCCATCATCATGCTAT
GGATGCTTGCATTACCAAGGCAAGCT -3’
Here is the sequence for the forward/right primer. 5’- CGTTCGTAATCTTGGTGAATTAAT-3’
a) Was this primer designed to bind the DNA strand given above or the complementary strand? Hint: you may want to write out the complementary sequence to this DNA sequence to help you answer this question.
b) Underline the bases where this primer will bind to its target sequence.
c) What is the first base that will be added by the Taq DNA polymerase that extends from this primer?
d) Assume the reverse/left primer is the same length as the forward/right primer, 24bp long.
i. What would the sequence be for this primer (indicate 3’ and 5’ ends of the primer)?
ii. Was this primer designed to bind the DNA strand given above or the complementary strand?
iii. What is the first base that will be added by the DNA polymerase that extends from this primer?
In: Biology
High-speed elevators function under two limitations: (1) the maximum magnitude of vertical acceleration that a typical human body can experience without discomfort is about 1.2 m/s2, and (2) the typical maximum speed attainable is about 9.1 m/s . You board an elevator on a skyscraper's ground floor and are transported 230 mabove the ground level in three steps: acceleration of magnitude 1.2 m/s2 from rest to 9.1 m/s , followed by constant upward velocity of 9.1 m/s , then deceleration of magnitude 1.2 m/s2 from 9.1 m/s to rest.
A)
determine the elapsed time for each of these 3 stages.
Express your answers using two significant figures separated by commas.
|
|
||||
|
tacc,tconstant,tdec |
B)Determine the change in the magnitude of the normal force, expressed as a % of your normal weight during each stage.
Express your answers using two significant figures separated by commas.
|
|
||||
| ΔFN,accFN,ΔFN,constantFN,ΔFN,decFN |
In: Physics
1. For the trait pod shape, pea plants are either inflated (Q), or constricted (q). Inflated is the dominant form. In the P generation, A homozygous dominant pea plant is crossed with a plant possessing the constricted phenotype. What would the genotype of the F1 generation be?
All possible genotypes would be seen in the F1 generation
2. In horses, a black mane (B) is dominant to a blond mane (b). A horse with a black mane is mated to one with a blond mane. They have several offspring, some with black manes and some with blond-manes. What is the genotype of the blond-maned parent?
can not be determined
Bb
bb
BB
3. Human ABO blood type is a non-mendelian trait. Three Alleles (IA, IB, and i) code for four blood types (A, B, AB, and O). Individuals with the genotype IA IB fully express both alleles, therefore the AB blood group is an example of…
Pleiotropy
incomplete dominance
codominance
polygenic inheritance
In: Biology
Use this study to answer the following six questions: A large company had several members of its board of directors arrested for embezzlement, widely reported in the national news in a negative manner. Their human resources department was concerned that the company's resulting reputational damage had a negative effect on their employees. The HR department administers a standard stress questionnaire to their employees annually, which has a mean score of 129.4 (higher numbers indicate more stress). They obtained a sample of 61 current employees and gave them the stress questionnaire after the negative news was publicized; results showed a mean of =131.2 and standard deviation of = 12.30. Did the news about the arrests increase employee stress?
Identify the null and alternative hypotheses:
What is the correct CV and decision rule for rejecting the null hypothesis?
What is the standard error?
What is the observed value of t?
What is eta2?
Write an APA style conclusion about the results, including properly formatted statistics, in the context of the study.
In: Statistics and Probability
Brucine is a bitter alkaloid closely related to strychnine. It occurs in several plant species, the most well known being the Strychnos nux-vomica tree, found in South-East Asia. While brucine is related to strychnine, it is not as poisonous. Nevertheless, a human consuming over 2 milligrams of pure brucine will almost certainly suffer symptoms resembling strychnine poisoning. For medicinal purposes, brucine is primarily used in the regulation of high blood pressure and other comparatively benign cardiac ailments. Brucine (C23H26N2O4 ; mm = 394.46 g/mol; Kb = 1.9 x 10-6) and strychnine (C21H22N2O2; mm = 334.41 g/mol; Kb = 1.8 x 10-6) form crystalline solids upon reaction with hydrochloric acid (stomach acid). Both brucinium chloride (C23H27N2O4+ Cl-; mm = 430.92 g/mol) and strychninium chloride (C21H23N2O2+ Cl-; mm = 370.87 g/mol) are very soluble.
What is the molar concentration (M) of a solution of brucinium chloride that has a pH = 5.77?
In: Chemistry
The principles of risk management are routinely applied in society (e.g. benefits of a drug vs. potential harmful adverse reactions in some patients). Risk management principles enable decision-makers to determine a balance between risk and cost to reduce that risk. The "safer" we engineer something, the more it costs. Using risk management, a "cutoff" point is decided upon, where further expenditures to further reduce risk are not "cost effective." Advances in instrumentation are allowing us to "discover" pollutants in treated wastewater that we couldn't detect previously due to their minute concentrations. The pollutants are introduced by human activity and many advocates they should, therefore, be removed, regardless of cost. The cost of removing minute traces of any pollutant is very high due to the low concentrations. The counter-argument is that the pollutants, previously un-measurable, have been in treated wastewater for generations and haven't caused harm.
Questions:
1. How should this be approached?
2. Does risk management have a role?
In: Civil Engineering
Q1-
A company wants to implement good internal control. What are the policies and procedures you can suggest to minimize human frauds and errors?
Q2-
Assume that you have a company. And the management team estimates that 3% of sales will be uncollectible.
Give any amount of sales and prepare the journal entry using the percent of sales method.
Q3-
A company that uses a perpetual inventory system made the following cash purchases and sales. There was no beginning inventory.
|
January 1: |
Purchased 30 units at SAR11 per unit |
|
February 5: |
Purchased 30 units at SAR 13 per unit |
|
March 16: |
Sold 50 Units for SAR 15 per unit |
A.Prepare general journal entries to record the March 16 sale using the
B. What is the cost of goods sold and the gross margin for each method?
Q4. What is the bank reconciliation? why is it important for companies to prepare bank reconciliation periodically?
In: Accounting
Overview and objective: Basic logic
In this homework, you will exercise your understanding of boolean logic and the gates and circuits that embody it. A thorough understanding of boolean logic is extremely useful for almost all programming tasks and necessary to correctly implement complex systems. Additionally, greater familiarity with boolean logic should improve one’s ability to think critically in general as it forms the basis for all human reasoning.
Technical Description and Instructions:
1. Consider the logical expression ( !x && y) && ! (x && !y). Make a truth table for this expression.
2. Construct a truth table for the expression (!x && y). Is the output column of the truth table the same as the previous expression’s truth table? What does this mean?
3. Simplify the following expressions using the boolean algebra properties with which you are familiar. Name the properties that you use to simplify them.
a) (x && y) && (x &&!y)
b) !x || (!y || x)
c) T || ( !y || x )
d) T && (( !y || x) || x )
In: Computer Science
Let's think about drug addiction and how American society treats individuals that have addiction problems. When someone is labeled a drug addict, they're identified by their problem and not as an individual. I thought this video provides an interesting alternative to our current policies.
Drug related arrests are also disproportionate if we examine factors such as race and income level. The speaker discusses the "war on drugs" and how it has not been very effective in combating drug addiction and drug use.
1. Do you think the war on drugs has been effective?
2. The speaker discusses two experiments on mice, one on solitude and one in "rat park". How are the results different in each experiment? How can we apply these two circumstances to human life?
3. What do you think are better solutions to reducing the rates of drug addiction.
4. What programs can help individuals recovering from drug addiction reconnect with society?
In: Psychology
Toll-Like Receptors (TLR) are essential for the internalization of pathogenic (E. coli K1) and non-pathogenic (E. coli DH5a) bacteria. Wnt5a, a cell differentiation, and immune response factor helps TLRs for internalization of both classes of bacteria. However, Wnt5a promotes the killing of only pathogenic bacteria but not non-pathogenic bacteria. Wnt5a is a secreted protein, which interacts with Frizzled (FZD) receptor FZD5. A specific locus in the genome of K1 is responsible for its pathogenicity and if this genomic segment is transferred to the genome of DH5a, DH5a becomes pathogenic and when this transformed DH5a strain infects human cells in the presence of Wnt5a, it gets internalized and killed. This ‘pathogenic genomic’ segment codes for a protein and non-coding RNA. Electron microscopy experiments at different times after infection following Wnt5a treatment show that after 1 hour of infection the two classes of bacteria reside in two types of intracellular vesicles.
Propose a model of how Wnt5a triggers pathogen killing (but not non-pathogen killing) and how to test that model.
In: Biology