Questions
Vaccines are a controversial subject and recently have been thrust into the public spotlight. This was...

Vaccines are a controversial subject and recently have been thrust into the
public spotlight. This was caused by the increase of anti-vaccination activists
and outbreaks of contagious diseases, like measles. Although the research
stating vaccines could result in autism was discredited and the publishing
physician lost his license permanently, the myth remains, kept alive on social
media.


Supporters say that vaccination is safe and point out that illnesses, including
rubella, diphtheria, smallpox, polio, and whooping cough, are now prevented by
vaccination and millions of children’s lives are saved. Opponents say that
children’s immune systems can deal with most infections naturally, and that
injecting questionable vaccine ingredients into a child may cause side effects,
including seizures, paralysis, and death.

In your opinion, should parents vaccinate their children or not? To strengthen your argument, use yourobservations and experiences, and information from your research.

Pick one topic and develop a well-developed thesis driven essay with research from Gale: Opposing Viewpoints located in HCCS library database. The paper will be 750-1000 word essay. You will need a minimum of 5 sources. You will have two quotes per body paragraph. You should have for and against argument. MLA style: 12 font, times new roman, double-spaced. Must include parenthetical citations and a works cited page.

In: Nursing

Question 1: What is the name of the utility used to manage software from the graphical...

Question 1: What is the name of the utility used to manage software from the graphical user interface.

Hint: Click on the activities menu and search for it.

            Answer:

Question 2: From the command line search the software repositories to find the chromium web browser. Provide the command used to find the package.

            Answer:

Question 3: From the command line use the software repositories to install the chromium web browser. How many dependencies will be installed alongside the browser? Provide the command used below.

Command:                 
Dependency #:           

Question 4: What command is used to update the Firefox web browser to the latest version using software repositories? If no update is available provide the command that would be used.

            Answer:

Question 5: What command is used to remove the chromium web browser.

Answer:

Question 6: What single command can be used to update all system and application software on Fedora Linux?

            Answer:

Question 1: What is the name of the utility used to manage software from the graphical user interface.

Hint: Click on the activities menu and search for it.

            Answer:

Question 2: From the command line search the software repositories to find the chromium web browser. Provide the command used to find the package.

            Answer:

Question 3: From the command line use the software repositories to install the chromium web browser. How many dependencies will be installed alongside the browser? Provide the command used below.

Command:                 
Dependency #:           

Question 4: What command is used to update the Firefox web browser to the latest version using software repositories? If no update is available provide the command that would be used.

            Answer:

Question 5: What command is used to remove the chromium web browser.

Answer:

Question 6: What single command can be used to update all system and application software on Fedora Linux?

            Answer:

In: Computer Science

I need project for impairment of goodwill , I need to look for a decline in...

I need project for impairment of goodwill , I need to look for a decline in the value of goodwill or in one of the issues below

Individual student needs to prepare a paper on one reporting issue. The paper shall consist of a proper description of issue, literature review, theory and empirical evaluation of actual companies data. Students are encouraged to discuss the forms, types and factors related to the issue. Examples of the issues include (but not limited to): -

1. Write off vs capitalizing In Process R & D especially in technology companies.

2. Gain on subsidiary stock sales.

3. Pushdown accounting

4. Goodwill write-off / impairment - recognition of loss in value, earnings power?

5. The effects of no par value shares.

6. Are impairments relevant for security valuation? And resulting earnings can predict future earnings better?

7. Whether fair value can explain stock price?

8. Use of special or non-recurring items

In: Accounting

The database is called GenBank and is searchable for specific sequences. You will compare your sequence...

The database is called GenBank and is searchable for specific sequences. You will compare your sequence to the database, find the closest matches and create a phylogenetic tree.

Please help with phylogenetic tree and a table using a NCBI (Blast):

the sequence is:

ATGACTAACATCCGTAAATCCCACCCACTAATCAAAATTATCAACCACTCATTCATCGATCTGCCCACCC

CATCAAACATCTCAGCCTGGTGAAACTTTGGCTCCCTGCTAGGAATCTGCTTAATCTTACAAATTCTAAC

CGGACTATTCCTTGCCATACACTACACACCAGACACAATAACTGCCTTCTCATCTGTCGCCCATATCTGT

CGAGACGTGAATTACGGCTGAATTATCCGCTATCTCCATGCCAACGGAGCATCCATATCCTTTATCTGCC

TATTCATCCACGTAGGACGCGGTATCTATTACGGATCATATACCTTCCTAGAAACCTGAAACATCGGAGT

TATCTTACTATTCACTCTAATAGCCACCGCATTCATAGGCTACGTCCTACCATGAGGCCAAATATCCTTC

In: Biology

Create a Database Schema for a hotel reservation system. indicate the Primary Keys, Foreign Keys, and...

Create a Database Schema for a hotel reservation system. indicate the Primary Keys, Foreign Keys, and the one-to-one or one-to-many relationships between the tables. Also describe in a small paragraph the scope of the back-end database, by explaining the different tables and their relations in your schema.

In: Computer Science

Design the database using the ER approach. Then using Java and SQL, implement the following functionality:...

Design the database using the ER approach. Then using Java and SQL, implement the following functionality:

Implement a button called “Initialize Database”. When a user clicks it, all necessary tables will be created (or recreated) automatically, with each table be populated with at least 10 tuples so that each query below will return some results. All students should use the database name “sampledb”, username “john”, and password “pass1234”.

Implement a user registration and login interface so that only a registered user can login into the system.

Create the functionality to assign three reviewers to a paper.

In: Physics

Develop a simple MIS (Management Information System) that consists of a simple database (a text file)....

Develop a simple MIS (Management Information System) that consists of a simple database (a text file). The system manages to dynamically input record/data into the database. The data from the database can be sorted, searched and updated. User also should be able to add new records/data, remove any data and etc.
Here are some ideas of MIS that can be developed:
1. Hotel reservation system.
2. Students management system.
3. Payroll management system.
4. Bus/Railway/Plane ticketing system.
5. Clinic record management system.

In: Mechanical Engineering

1. Please briefly describe in one short paragraph a valuable business problem that you are interested...

1. Please briefly describe in one short paragraph a valuable business problem that you are interested in solving and how designing a database can help in solving this problem. You should treat this database design project as something you can put on your CV and explain to potential employers (or potential investors if you are pursuing a startup).

2. Create three tables that you will use in your database. Write the SQL code (can be done in PgAdmin or in MS Word etc.). Then write a short paragraph explaining the purpose of each table.

In: Computer Science

Develop a simple MIS (Management Information System) that consists of a simple database (a text file)....

Develop a simple MIS (Management Information System) that consists of a simple database (a text file). The system manages to dynamically input record/data into the database. The data from the database can be sorted, searched and updated. User also should be able to add new records/data, remove any data and etc.
Here are some ideas of MIS that can be developed:
1. Hotel reservation system.
2. Students management system.
3. Payroll management system.
4. Bus/Railway/Plane ticketing system.
5. Clinic record management system.

In: Mechanical Engineering

Explain: (a) Myelinated axon: Some neurons, like most of the neurons in human body, have myelinated...

Explain:

(a) Myelinated axon: Some neurons, like most of the neurons in human body, have myelinated axons; the axons are wrapped around with segmented myelin sheaths. When compared with unmyelinated axons of the same axon diameter, the neural signal transmission speed along myelinated axons is much faster than that along unmyelinated axons. Qualitatively and briefly explain why.

(b) Hopfield model: Hopfield model can be considered as a form of neural net algorithm of retrieving information from a large database. When we compare the functioning of the Hopfield model with that of conventional database algorithms where information retrieval is carried out by examining all the entries in the entire database, one at a time, in view of retrieval criteria, what are the most significant differences? Qualitatively and briefly describe at least two significant differences. Assume that the database is very large.

In: Biology