11.   _____________________organization is organization by time – from earliest to most recent (forward in time) or from recent events back into history (backward in time).

                          (a) Primacy;   (b) Recency   (c) Chronological;   (d) Integrated

                 12 . If your topic is controversial, you may want to organize your main ideas according to the principle of _____________, or putting the most important or convincing idea first.

1. primacy; (b) recency; (c) chronological; (d) integrated

13. ­­­­­­­­­­­­­­­­­­­_______________ are words and gestures that allow you to move smoothly from one idea to the next throughout your speech, showing   relationships between ideas and emphasizing important points.

          (a) Outlines;     (b) Topics;    (c) Demeanors; (d) Guideposts

14 . _________________ produce word pictures and detailed information that allows an audience mentally to see, hear, smell, touch, or taste what you are describing.

          (a) Explanations;   (b) Descriptions;   (c) Definitions; (d) Details

15. _______________ are used by speakers who discuss or demonstrate processes of any kind. Used in How to Speeches.

(a) Explanations;   (b) Descriptions;   (c) Definitions; (d) Details

16 . In a country in which free speech is protected by law, the right to speak freely must be balanced by the responsibility to speak ethically In 1791, the_____________ Amendment to the Constitution was written to guarantee   freedom of speech.

1. 2^nd        (b) 1^st       (c) 3^rd          (d) 4^th

17. _____________________ is the ability to understand and manage one’s own moods and emotions, as well as the moods and emotions of

others.

          (a) intelligence quotient;           (b) emotional intelligence;

          (c ) intelligence level;                0(d) emotional level

18. ____________________ involve the ability to perform tasks in a specific discipline (such as selling a product) or department (such as marketing.)

          (a) technical skills,                  (b) human relations skills

          (c ) conceptual skills;               (d) mundane skills

19. ________________ involve communication and motivation; they enable managers to work through and with people. A people person.

          (a) technical skills,                  (b) human relations skills

          (c ) conceptual skills;               (d) mundane skills

20.   ____________________ involve the ability to picture the organization as a whole and the relationships among its various parts. Ability to diagnose

(a) technical skills,                  (b) human relations skills

          (c ) conceptual skills;               (d) mundane skills

A standardized testt consists of three parts: math, writing, and critical reading. Sample data showing the math and writing scores for a sample of 12 students who took the testt follow.

(a)

Use a 0.05 level of significance and test for a difference between the population mean for the math scores and the population mean for the writing scores. (Use math score − writing score.)

Formulate the hypotheses.

H₀: μ_d = 0

H_a: μ_d ≠ 0

H₀: μ_d ≠ 0

H_a: μ_d = 0

H₀: μ_d ≤ 0

H_a: μ_d = 0

H₀: μ_d > 0

H_a: μ_d ≤ 0

H₀: μ_d ≤ 0

H_a: μ_d > 0

Calculate the test statistic. (Round your answer to three decimal places.)

Calculate the p-value. (Round your answer to four decimal places.)

p-value =

What is your conclusion?

Reject H₀. We can conclude that there is a significant difference between the population mean scores for the math test and the writing test.Reject H₀. We cannot conclude that there is a significant difference between the population mean scores for the math test and the writing test.     Do not reject H₀. We cannot conclude that there is a significant difference between the population mean scores for the math test and the writing test.Do not reject H₀. We can conclude that there is a significant difference between the population mean scores for the math test and the writing test.

(b)

What is the point estimate of the difference between the mean scores for the two tests? (Use math score − writing score.)

What are the estimates of the population mean scores for the two tests?

MathWriting

Which test reports the higher mean score?

The math test reports a  ---Select--- (higher or lower) mean score than the writing test.

A full-service car wash has an automated exterior conveyor car wash system that does the initial cleaning in a few minutes. However, once the car is through the system, car wash workers hand clean the inside and the outside of the car for approximately 15 to 25 additional minutes. There are enough workers to handle four cars at once during this stage. On a busy day with good weather, the car wash can handle up to 150 cars in a 12-hour time period. However, on rainy days or on certain days of the year, business is slow. Suppose 50 days of work are randomly sampled from the car wash’s records and the number of cars washed each day is recorded. A stem-and-leaf plot of this output is constructed and is given below. Study the plot and write a few sentences describing the number of cars washed per day over this period of work. Note that the stem-and-leaf display is from Minitab, the stems are in the middle column, each leaf is only one digit and is shown in the right column, and the numbers in the left column are cumulative frequencies up to the median and then decumulative thereafter.

From the stem and leaf display, the original raw data can be obtained. For example, the fewest number of cars washed on any given day are ____. The most cars washed on any given day are _____. The modal stems are 3, 4, and 10 in which there are ___ days with each of these numbers. Studying the left column of the Minitab output, it is evident that the median number of cars washed is ____. There are only ___ days in which 90 some cars are washed (90 and 95) and only _____ days in which 130 some cars are washed (133 and 137).

We’ve very briefly covered that an equilibrium constant Keq = [products]/[reactants] can also be expressed as kfwd/krev. To derive this, remember that at equilibrium, kfwd[reactant] = krev[product]. Divide both sides by [reactant] and by krev, and you will find that kfwd/krev = [product]/[reactant].

a. With enzymes that follow the Michaelis‐Menten kinetic mechanism (they don’t all, but in this class we’ll limit our discussion to them), if the kcat is much less than k‐1, the KM is approximately equal to the KD. Explain why this is, and what the KM would tell us about the enzyme in such a circumstance.

b. In the situation described in (a), does the E+S⇌ES reaction (described by the KD) reach equilibrium?

c. With enzymes that follow the Michaelis‐Menten kinetic mechanism, if the kcat is comparable to k‐1, the KM tends to be much larger than the KD. Under these conditions, would the E+S⇌ES reaction be at equilibrium?

d. Under the condition of part (c), would the concentration of [ES] be higher or lower than if kcat << k‐1?

e. When kcat ≈ k‐1, how should we interpret the KM? How is this different from the kcat << k‐1 case?

The use of DNA analysis to identify individuals is known as

A. PCR testing B. DNA fingerprinting C. cloning D. None of these

DNA identification of individuals is possible because

A. individuals, other than identical twins, are genetically unique

B. a different restriction enzyme is needed to cut each person’s DNA

C. a different species of bacteria is needed for the DNA library of each person

D. each person’s DNA uses a different set of bases

Which of the following sources would NOT be suitable for DNA fingerprinting analysis?

A. saliva B. hair C. semen D. red blood cells E. urine

Small circular DNA molecules accompanying the main DNA of the bacterial chromosome in a bacterial cell are called

A. jumping genes B. ligases C. polymerases D. plasmids

Procedures that manipulate the genes of organisms are referred to as

A. DNA fingerprinting C. genetic engineering

B. bacteriophages D. new genetics

Your child is taking an antibiotic that blocks ribosomes in the pathogenic (disease-causing) bacteria from binding with mRNA. Which of the following processes will not occur in the pathogenic bacteria?

A. transcription B. photosynthesis C. translation D. osmosis

[Briefly explain and answer 1-3]

1.Experimentally, using both kinetic and other approaches, how would you distinguish between an irreversible and a reversible inhibitor? Assume that the inhibitor is a low molecular weight compound.

2.In enzyme kinetics, a key point in the generation of meaningful data is the accurate measurement of the initial velocity. What are the problems associated with the determination of the initial rates? What approaches can be used to avoid these problems?

3.During a protein purification procedure, the following takes place:

a.The sample is prepared, homogenized, boiled, and ammonium sulfate is added the supernatant. The protein that is of interest precipitates along with 5 other proteins.

b.The ammonium sulfate pellet is resuspended in a 6M urea buffer.

c.Upon clarification of the resuspended pellet, the supernatant is loaded onto a CM column.

d.Several proteins come off during the column wash. Two proteins come off as we elute the proteins using a salt gradient.

What information can be gained from (a) relative to our protein of interest?

What information can be gained from (d) relative to our protein of interest?

Propose a method to separate the two proteins that eluted from (d).

Jacob and Monod discovered a constitutive mutation of the lacI gene (lacIC). Bacteria with the chromosomal genotype lacIC lacO+ lacZ+ lacY+ express high levels of both β-galactosidase and lactose permease in either the presence or absence of lactose. Which of the following mutations could have yielded this phenotype?

The mutant lacIC protein is unable to bind cAMP.

The mutant lacIC protein is unable to bind the lacO+ DNA sequence.

The mutant lacIC protein is unable to bind allolactose.

The mutant lacIC operator cannot bind CAP

Either the mutant lacIC protein is unable to bind the lacO+ DNA sequence or the mutant lacIC operator cannot bind CAP could explain these results.

You have taken a new job in a forensic laboratory, and your task is to use PCR to test for the presence of specific sequences in very small quantities of DNA. What components do you require for this task?

A plasmid vector containing T3 and T7 primer sites.
Genome-specific primers, dNTPs, and Taq polymerase
E. coli DNA polymerase
A thermostable reverse transcriptase enzyme from hot springs bacteria

Answer and explain the choice of your answer.

James 28-year-old has a history of multiple unprotected sexual partners comes to clinic because of low-grade fever and rash. He also complained of recurrent fatigue, headache, malaise and sore throat for almost two years. Physical examination reveals 38.9 grade fever, mucosal ulceration, inflamed tonsils and mild lymphadenopathy. Rashes on his face, lower and upper trunk is also present.

            Laboratory results showed anemia (hematrocrit 37%) with marked decrease in total white blood cell count and absolute lymphocyte count.

Which of the following is most likely the diagnosis?
a) acute HIV
b) latent HIV
c) HIV infection
d) AIDS

If James is suspected of retroviral infection, which of the following is the most appropriate laboratory test to aid in the diagnosis?
a) Cell culture
b) Enzyme Immunoassay
c) Western Blot
d) Nucleic Acid Test

Marked decrease in total white blood cell count in this disease is a result of which of the following mechanisms?
a) defective cell-mediated immunity
b) leukopenia
c) helper T cell destruction
d) apoptosis

Background information:

1.       Temperature-sensitive cell cycle (cdc) mutants are important tools for studying cell cycle. These mutants grow and divide normally at low temperature but express the mutant phenotype at higher temperature.

2.       Hydroxyurea inhibits the enzyme ribonucleotide reductase, and thus blocks DNA synthesis. Hydroxyurea inhibition of cell cycle can be overcome by changing the incubation media to remove the drug.

Experimental design and results:

A.      A culture of cdcx mutations is incubated at 37°C for two hours (the approximately length of the cell cycle in yeast), and then transferred to a medium containing hydroxyurea at 20°C.

a.       None of the cdcx mutants divide.

B.      You first incubate cdcx cells at 20°C for 2 hours with hydroxyurea, and then transfer them to a medium without the drug at 37°C.

a.       The cdcx mutants divide once.

C.      You repeat these two experiments with the cdcy mutant cells.

a.       The cdcy mutant cells do not divide in either experiment.

·         Identify what phase of the cell cycle the cdcx mutant cells are blocked at for the restrictive temperature. Provide reasoning.

·         Identify what phase of the cell cycle the cdcx mutant cells are blocked at for the restrictive temperature. Provide reasoning.

What kinds of materials obtained from a crime scene might contain DNA? (2 pts)

Consider the following DNA molecule

5ʹ CCTTGGGGCCAATTGGCCGTACCGAATTCGCCGAATTCCGGAATTGGCCTACGGGCTCGGGCCGG 3ʹ

3ʹ GGAACCCCGGTTAACCGGCATGGCTTAAGCGGCTTAAGGCCTTAACCGGATGCCCGAGCCCGGCC 5ʹ

How many bp is the original fragment? (1 point)

The enzyme HaeIII has the following restriction site    5ʹ GG˅CC 3ʹ          

                                                                                3ʹ CC˄GG 5ʹ

If digested with HaeIII, how many fragments are formed if the DNA is linear? (1 point)

If digested with HaeIII, how many fragments are formed if the DNA is circular? (1 point)

Consider the following DNA molecule

5ʹ ATTCGCGAATTCGGTACCGAATTGGCAGATTCGCCGAATTCCCGTACGGAATTAGTTAAC 3ʹ

3ʹ TAAGCGCTTAAGCCATGGCTTAACCGTCTAAGCGGCTTAAGGGCATGCCTTAATCAATTG 5ʹ

How many bp is the original fragment? (1 point)

(Recognition site for EcoRI is given previously)

If digested with EcoRI, how many fragments are formed if the DNA is linear? (1 point)

If digested with EcoRI, how many fragments are formed if the DNA is circular? (1 point)

Using the results from question #2 (for linear DNA), draw the results on a gel( “—“ = the well). Well A contains the complete, intact, undigested sample/sequence; well B contains digested sample/sequence. (4 points)

A                 B