2.. The diagram below illustrates the human DNA nucleotide sequence containing the somatostatin gene. (2)

• Highlight in red the bases between which EcoRI cuts on each strand of the DNA sequence.

• Highlight in turquoise the bases between which BamHI cuts each strand of the DNA sequence.

5’ 3’

GAATTCATGGCTGGTTGTAAGAACTTCTTTTGGAAGACTTTCACTTCGTGTTAGTAGGATCC

3’ 5’

CTTAAGTACCGACCAACATTCTTGAAGAAAACCTTCTGAAAGTGAAGCACAATCATCCTAGG

Describe the features of the gene organization and the gene structure between bacteria and human. How do these differences of genomic features provide evolutionary adaptations to prokaryotic and eukaryotic organismal functions.

Why are multiple specific bacterial tester strains used in the Ames test? Illustrate with a diagram, how can the toxic and mutagenic effects be distinguished from the anticipated results?

Discussion:

**In one's culture, the elderly and those with severe handicaps are put to death. it will appear that this culture does not recognize human dignity as a value?

** Copyright law makes it illegal to copy computer programs. Yet sometimes students wants or need a program that is too expensive for them to buy. In such cases, is it morally acceptable for students to copy a friend software?

What are the pros and cons of using technology and quantitative data to trace, monitor, and address human rights violations? Overall, do you think that the pros outweigh the cons or not? Why? Use specific examples from the slides and the book.

Answer this prompt in at least two or three paragraphs, clearly stating your argument and supporting the argument with evidence.

Of the three pizza-making technologies discussed in relation to the production function, the human technology (i.e., Pali the Pizza-maker) appeared to be the least efficient in terms of total factor productivity (TFP) and the frozen pizza production technology appeared to most efficient in terms of TFP. Identify a limitation of using TFP as a measure of evaluating alternative production processes.

Explain how alteration in DNA sequences contribute to variation that can be subject to natural selection. (Please use these terms in your answer)

Chromosome number

Chromosomal human disorders: down syndrome, turner syndrome

Natural selection

Horizontal acquisitions  

Naked DNA

Viral transmission

Conjugation

Transposition

Viruses recombination

Meiosis(in various organisms)  

As a health care manager, what steps can you take to apply the above Human Resources Management functions to create and advance an organizational community of physicians, managers, and staff that is unified in and committed to achieving the mission and living the values of the organization?

Above mentioned HRM functions: job analysis, workforce planning, retention, employee performance assessment, and recruitment

Of the three pizza-making technologies discussed in relation to the production function, the human technology (i.e., Pali the Pizza- maker) appeared to be the least efficient in terms of total factor productivity (TFP) and the frozen pizza production technology appeared to most efficient in terms of TFP. Identify a limitation of using TFP as a measure for evaluating alternative production processes.

1. Drug effects at receptors are a combined results of the drugs affinity for the receptor and an inherent property of the drug known as its:
A) potency
B) cooperativity
C) intrinsic activity

2. The term xenobiotic refers to
A) drug metabolism by bacteria
B) metabolism by non-human organisms
C) a foreign molecule not normally found in the body. It may or may not be a drug.