Question 55:

Please indicate the diseases or conditions described in each section below. [5 marks]

(a) Billions of people consume unregulated concentrations of a fungal toxin, an alkylating agent, in their staple foods (corn, ground-nuts, rice). What condition arises from consumption of:

• acute, high doses?                        
• chronic, low doses?                        

(b) What is the painful inflammatory condition that occurs in joints when macrophages phagocytose crystals of a common metabolite?                              

(c) What severe inflammatory condition is characterised by damage to secretory cells or ducts that deliver digestive enzymes (such as lipases) to the gut, and by the precipitation of salts of fatty acids?                               

(d) What potentially lethal body-wide inflammatory state is induced if an injury leads to a large amount of intracellular material being liberated into the bloodstream?                                   

(e) Name chronic inflammatory diseases affecting the gut, associated with dysbiosis, and showing ulceration and fibrosis that:

• may occur at any site in the alimentary canal                        
• are localised to the large intestine:                        

For my chemistry final, we're identifying 5 unknowns, one acid, one base, one chloride salt, one nitrate salt, and one sodium salt . On the list of possible unknowns, there are:
three acids (HCl, HNO3, or HSO4)
three bases (NaOH, NH3, or NaS)
three chloride salts (NaCl, BaCl, or CuCl)
three nitrate salts (AgNO3, Cu(NO3)2, or Fe(NO3)3
three sodium salts (NaI, Na2SO4, or Na2CO3)

We will be given 5 test tubes each containing one of the substances from each category above. If anyone could provide a flowchart and/or explaination (IN Steps) on how I could identify each unknown category, please help???

Please dont give me this answer https://answers.yahoo.com/question/index?qid=20140527021948AAsGNL8
i copy and paste my question from there, I wanted another insight unless there's no other way other than that way?

Can you please paraphrase the whole answers with the same thought written in the answer, because that is answered by me and my friend, we have to have different answers.

Trematodes case study

A stool specimen was received in the laboratory, It was collected from a 35-year old man from Xinjiang, China as a part of refugee health screening program. The stool was preserved using 10% formalin and Formalin-Ethyl Acetate concentration was done. A wet mount smear was prepared from the sediment and examined. The Eggs seen measured 26-32 micrometers long. The pictures below were seen in the smear.

Questions to answer:

1. What is your diagnosis? Based on what criteria?

Bases on the criteria above the man is living in china. There is one parasite that is named the Chinese liver fluke. This is also called the Clonorchis sinesis. This parasite is endemic in the areas of the Far East including the China. Also based on the pictures you can see that the eggs of the parasite has an operculum and this is unique only to this parasite. You can also see the presence of distinct shoulders and the presence of the small knob opposite operculum in the eggs based on the pictures above.

Reference:

Zeibig, Elizabeth A. (2013). Clincal Parasitology: A Practical Approach. 2nd Edition

2. How does Human get infected with this parasite?

The human gets infected with this parasite when they ingest an undercooked fish. Now this Fish is contaminated with the encysted metacercaria. The immature flukes will mature in the liver of the human when the human has ingested the contaminated fish. The bile duct is where the adult worm will live and this is the final part of the cycle.

Reference:

Zeibig, Elizabeth A. (2013). Clincal Parasitology: A Practical Approach. 2nd Edition

3. How does adult form of this parasite frequently recover? Can they be seen in stool or duodenal aspirate?

The adult forms of this parasite are only rarely seen. They are seen when there is a surgery or autopsy procedure for the patient. The most morphologic seen in this parasite is the eggs. They are seen in the stool specimens. So my answer if the adults can be seen in stool or duodenal aspirate the answer is no. That is because it can only be seen when there is a surgery that is performed or and autopsy procedure is in progress.

Reference:

        Zeibig, Elizabeth A. (2013). Clincal Parasitology: A Practical Approach. 2nd Edition

1.Which is true about sickle-cell anemia? Choose all that are true.

The allele that causes the disease is recessive.

Natural selection favors the heterozygote in areas with malaria.

The mutation that causes it is a SNP.

People homozygous for the sickling allele experience episodes of severe pain that may permanently damage their vital organs.

2.What was probably a selective pressure against dark skin in the our earliest ancestors to leave Africa?

Spina bifida from excessive ultraviolet light.

Rickets from a Vitamin D deficiency.

Lactose intolerance.

A combination of sickle-cell anemia and malaria.

3.What must have been the original cause of lighter skin color in our ancestors?

Skin cancer

Mutation

Natural selection

Rickets

4.The major differences among human populations today are in

anatomy (such as facial structure).

culture (no consistent biological differences).

cephalic index (measurements of the skull).

skin color (measured as reflectance).

5.There are many ways to classify humans. Which of the following is WRONG?

As strepsirhines.

As catarrhines.

As primates.

As apes.

6.The differences between strepsirhines and haplorhines include nose structures.

False

True

7.Which of the following is true about non-human ape material culture?

They use tools, but they don't make them.

They make and use tools, but only in captivity.

They don't use tools.

Chimpanzees make and use tools, but not the other non-human apes.

All the Great Apes make and use tools in the wild.

8.Which of the following is true about non-human primate communication? Choose all that are right.

They don't communicate.

They have languages.

Some monkeys have specific alarm calls for different predators.

Haplorhines communicate with facial expressions.

Lemurs and lorises communicate with scent.

9.Using a relative dating technique, we could determine:

if a fossil qualified as a relative of the primates

the exact age of a given fossil relative

whether one fossil is younger or older than another fossil

10.What can you date with radiocarbon dating?

Fossil bones of Turkana Boy.

Anything that was once alive within the last 50,000 years.

Layers (strata) between 50 and 100 kya.

Volcanic materials older than 100,000 years.

Environmentalism and Moral Concern for Animals Many believe that we are in serious trouble today as human beings plunging headlong into a major climate crisis on planet earth. Our course eText on Environmental Ethics states the following: There is no denying that the global climate is changing, as the level of carbon dioxide in the atmosphere has increased during the past century. … Coastlines are crumbling as the climate changes and sea levels rise… storms are increasing in severity … the Arctic ice cap is melting… (MacKinnon, 427). But what’s causing these troubling changes? We are. MacKinnon again: Some skeptics dispute whether the changes are entirely man-made, but the vast majority of experts believe one of the major causes of climate change is the burning of fossil fuels … (MacKinnon, 428). And the human disregard for nature also means disregard for all species of animals that depend on livable natural habitats. Entire species today are threatened with imminent extinction. Writing in 2016, MacKinnon says “687 animal species are listed as either endangered or threatened.” That number has risen drastically since 2016, leading some scientists to conclude that we are in the midst of a global mass extinction of animal species. The following video links provide, in the first, a summary of a U.N. Climate Change Report from 2019, and, in the second, an explanation of the meaning of speciesism by Dr. Richard Ryder. After watching these short videos, please respond to the discussion questions listed below. U.N. Climate Change Report: LINK (Links to an external site.) Dr. Richard Ryder on the meaning of speciesism Link (Links to an external site.) Discussion Questions (please address both 1 and 2). [1] How does the hearing of this U.N. report on the climate crisis affect you, your values, your sense of the world and its future? What human beliefs or values today will more likely prevent needed changes in our way of life, methods of production, or government policies? And what beliefs or values will more likely lead to the kind of changes needed to address the climate crisis? [2] Do you think humans are biased against animals, as moral philosophers like Peter Singer express with the term speciesism, and do you think this speciesism is comparable to other human biases such as racism and sexism, as Dr. Ryder contends in the video?

Why or why not?

Experiment 2: Cloning a DNA Fragment to a Bacterially-Derived Plasmid Vector

Bacteria frequently contain extrachromosomal plasmids, which are circular DNA genetic elements that are self-replicating. Plasmids are typically not necessary for the bacteria's survival but can sometimes confer a growth advantage to the bacteria. Plasmids can be transferred between bacteria and recombinant DNA technology makes use of this feature to introduce “foreign” genes into bacteria and use the bacteria as a cell “factory” to produce the gene. Genes are inserted into plasmids (also called vectors) by means of restriction enzymes. Restriction enzymes are bacterially derived enzymes that recognize specific DNA sequences and cut (or restrict) that particular DNA sequence in a consistent way. That is, any DNA that contains a particular restriction enzyme sequence will be cut the same. Restriction enzymes often produce overhanging ends of DNA (called sticky ends) that can adhere to each other through hydrogen bonding then DNA ligase permanently links the pieces together by forming covalent bonds between the phosphate backbones of the DNA, creating a recombinant or genetically engineered DNA. In this experiment, you will be given two sequences of DNA: one sequence is a foreign gene and the other sequence is of a plasmid vector. You will use a computer program to identify where the common restriction sites for both sequences occur. Scientists perform this type of computer simulation prior to performing restriction enzyme digestion to ensure that they will cut the sequences as expected.

Procedure

Type the link listed in the materials box for the NEB Cutter website into a web browser (note, cutting and pasting the link from a PDF file format will not work. You must manually type in the address).

Copy and paste the foreign DNA sequence into the box on the NEB Cutter website where it says “Paste In Your DNA Sequence”. Foreign DNA Sequence:

GAATTCGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGT

CGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGC

GAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGG

CAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGC

AGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCG

CCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCA

ACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCA

TCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGC

TGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAAC

GGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGC

TCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCC

CGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGC

GCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATG

GACGAGCTGTACAAGGGATCC

Title the sequence as “Foreign DNA” in the “Name of Sequence” box. Leave the other settings on their default status.

Click the “Submit” button (located to the right of the pasted DNA sequence).

On the new page that opens, select “Custom Digest” under the “Main Options” heading on the left side of the page.

The new page that opens will contain a list of restriction enzymes. Select the enzymes BamHI and EcoRI then click on the “Digest” button at the bottom of the page.

On the new page that opens you will see a linear representation of your DNA. Select “Fragments” under the “List” heading on the right side of the page.

Record the length of the longest fragment in Table 1. This fragment contains the sequence of the foreign DNA. The short fragments are the left over ends from the restriction enzyme digest. Close this window.

Return to the NEB Cutter homepage. Copy and paste the plasmid gene sequence into the box on the NEB Cutter website where it says “Paste In Your DNA Sequence”. Plasmid DNA Sequence:

GTTAACTACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTG

TTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATA

AATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCG

CCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACG

CTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATC

GAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGT

TCTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTG

TTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACT

TGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAG

AGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTT

CTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGG

GATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAA

ACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAAC

TATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATG

GAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGG

TTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGC

ACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGT

CAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGAT

TAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTACCCC

GGTTGATAATCAGAAAAGCCCCAAAAACAGGAAGATTGTATAAGCAAATATTTAAATT

GTAAACGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTT

AACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGCCCGAGATA

GGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCC

AACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATC

ACCCAAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAA

AGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCGAACGTGGCGAGAAAGGAAG

GGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGC

TGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTAAAA

GGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTT

TTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCC

TTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGT

GGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAG

CAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTT

CAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGC

TGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACC

GGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTG

GAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGC

CACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGA

ACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCC

TGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGG

GCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTG

CTGGCCTTTTGCTCACATGTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTT

ACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCAC

ACAGGAAACAGCTATGACCATGATTACGCCAAGCTACGTAATACGACTCACTATAGGG

CAGATCTTCGAATGCATCGCGCGCACCGTACGTCTCGAGGAATTCCTGCAGGATATC

TGGATCCACGAAGCTTCCCATGGTGACGTCACCGGTTCTAGATACCTAGGTGAGCTC

TGGTACCCTCTAGTCAAGGCCTATAGTGAGTCGTATTACGGACTGGCCGTCGTTTTAC

AACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCC

CCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACA

GTTGCGCAGCCTGAATGGCGAATGGCGCTTCGCTTGGTAATAAAGCCCGCTTCGGCG

GGCTTTTTTTT

Title this sequence as “Plasmid DNA” in the “Name of Sequence” box. Select “Circular” by the heading “The sequence is:”. Leave the other settings on their default status.

Click the “Submit” button (located to the right of the pasted DNA sequence).

On the new page that opens, select “Custom Digest” under the “Main Options” heading on the left side of the page.

The new page that opens will contain a list of restriction enzymes. Select the enzymes BamHI and EcoRI then click on the “Digest” button at the bottom of the page.

On the new page that opens you will see a circular representation of your DNA. Select “Fragments” under the “List” heading on the right side of the page.

Record the length of the longest fragment in Table 1. This fragment contains the majority of the plasmid DNA sequence. The short fragment is the excised plasmid DNA that lies in between the two restriction enzyme sites.

Q: Identify where the common restriction sites for both sequences occur?

IBM and Its Human Resources It had been a very bad morning for John Ross, the general manager of MMC’s Chinese joint venture. He had just gotten off the phone with his boss in St. Louis, Phil Smith, who was demanding to know why the joint ven- ture’s return on investment was still in the low single dig- its four years after Ross had taken over the top post in the operation. “We had expected much better performance by now,” Smith said, “particularly given your record of achievement; you need to fix this John! Our patience is not infinite. You know the corporate goal is for a 20 percent return on investment for operating units, and your unit is not even close to that.” Ross had a very bad feeling that Smith had just fired a warning shot across his bow. There was an implicit threat underlying Smith’s demands for improved performance. For the first time in his 20-year career at MMC, Ross felt that his job was on the line. Back in the early 2000s IBM’s CEO at the time, Sam Palmisano, set out to recreate IBM as a globallyintegrated enterprise that would provide its customers IBM products and services—software, hardware, busi- ness processing, consulting, and more—wherever and whenever they needed it. Underpinning Palmisano’s vi- sion was a realization that globalization was proceed- ing rapidly, and that many of IBM’s customers were themselves increasingly global enterprises. Global customers wanted to deal with one IBM, not many different national units. Palmisano also understood that for IBM to build a sustained competitive advantage in this new world, it would have to have world-class human capital. People and their acquired skills, he realized, were the foundation of competitive advantage. Companies that rely on technological or manufacturing innovations alone cannot be expected to dominate their markets indefi- nitely. Competitors can and do catch up. In Palmisano’s view, the quality and strategic deployment of human capital is what separates winners from also-rans. This was particularly true for a company like IBM, which increasingly relied on its people to build and deliver world-class services. To execute his strategy, Palmisano created global prod- uct divisions, but that alone was not enough. He realized that IBM’s existing human resource systems were not aligned with the new strategy. Much of the hiring, train- ing, and staffing functions of HR were still based in na- tional units. The company lacked a global approach to managing and deploying its human capital, and execut- ing Palmisano’s vision required this. That insight was the genesis for what became known as the Workforce Management Initiative (WMI) at IBM. Established by the global human resource group, the purpose of this initiative was to create for the first time a single, integrated approach to hiring, managing, and de- ploying IBM’s global workforce. The ultimate goal was to enable the company to find and deploy the best people within the company to help solve client problems or respond to their requests. For this to work, HR had to become intimately involved in understanding the busi- ness strategy of different IBM units and the implications that business strategy holds for human resource deploy- ment. Unless HR had a seat at the strategy table, it could not properly identify and provide the right people to exe- cute a unit’s strategy. As it progressed, the WMI involved investing more than $100 million to create a companywide database to document the skills of more than 400,000 employees at IBM, measure the supply and demand for different skills and capabilities, and seek to match human capital with specific projects. The goal was to get the right person, with the right skills, at the right time, place, and cost. For example, when a health care client needed a consultant with a clinical background, a search using the WMI data- base immediately targeted a former registered nurse who was now an IBM consultant. By improving the efficiency of its internal labor market and leveraging its global workforce, IBM estimates that the WMI database saved the company as much as $1.4 billion in its first four years in operation. The WMI database has a number of other benefits. It helps employees make career decisions, as by accessing it they can see which skills are in demand. Moreover, by identifying potential mismatches between the supply and demand of skills, it drives decisions about internal man- agement development and training programs, enabling IBM to identify with precision which skills its employ- ees need to acquire for the company to maintain its com- petitive edge going forward. In 2013, under the watch of new CEO Virginia “Ginni” Rometty, IBM continued the workforce devel- opment offerings by launching its Smarter Workforce Initiative, bringing together the products and services of Kenexa with IBM. Kenexa was acquired by IBM for $1.3 billion in late 2012, and it brought together vari- ous solutions within IBM such as employee assess- ment and psychology, employee engagement tools and offerings, employee branding and recruitment out- sourcing, and talent management software. The Smarter Workforce Initiative was IBM’s venture into a highly competitive space of HR solutions and soft- ware, with Oracle, SAP, and others having been in the market for a long time. With its internal Workforce Management Initiative and its externally focused Smarter Workforce Initiative, IBM was positioning it- self to be a major force in global human resource management.

Please write a summary of the case.

BIOCHEMISTRY (CELLULAR RESPIRATION/ELECTRON TRANSPORT CHAIN)

1) Steps of cellular respiration are: (multiple answers may be correct)

A. Fermentation

B. Oxidative carboxylation of pyruvate

C. Citric Acid Cycle

D. Mitochondrial Electron Transport Chain

E. Reduction of molecular Oxygen by cytochrome C.

2) Steps of Oxidative Phosphorylation (in a wider sense) are: (multiple answers may be correct)

A. Fermentation

B. Glycolysis

C. Mitochondrial electron transport chain

D. Reduction of molecular Oxygen by cytochrome C

E. H+ gradient driven synthesis of ATP

3) Which of the following is correct? (only one answers is correct)

4) The amount of free energy changes during redox reactions depends on (only one answer is correct)

Case 1

A 26-year-old female complained of severe, dull, aching pain, and cramping in the lower abdomen. There were no other physical findings. A laparoscopy revealed the presence of ectopic endometrial tissue on the uterine wall and ovaries. Danazol (a synthetic androgen and inhibitor of gonadotropins), 600 mg/day, was prescribed for up to nine months to inhibit ovulation, suppress the growth of the abnormal endometrial tissue, and achieve appreciable symptomatic relief, with a 30% possibility of conception after withdrawal of the therapy.

• What is this condition called?
• What causes it?
• Why do you think oral hormonal contraceptives could also be used as a treatment – how can they help reduce the patients pain?
• Hormonal contraceptive therapy is also used to prevent pregnancy. Describe three ways oral contraceptive pills can prevent fertilization and pregnancy.

Case 2

A 67-year-old retired male went to his doctor, complaining initially of leg pain that started in his lower back, which then radiated down across the side of his thigh and over the front of his knee. Subsequently, he developed pain that radiated from his back to his front at two different levels: at the chest through the level of his nipples and also at the umbilicus.

His physician performed a history and physical, followed by laboratory tests. He discovered a hard nodule on his prostate and an elevation in several of the blood tests. His PSA (prostate specific antigen), an enzyme secreted by normal prostate tissue (0-4 ng/ml) was 450. Alkaline phosphatase was also elevated at 157 U/L, an indication of bone involvement.

A bone scan was ordered to visualize the bone involvement. (This test uses a calcium analogue attached to a radioactive tag. A special scanner can pick up images of this radioactivity and create an anatomical picture of the skeletal system. The radiation shows up as black spots on the film.)

Usually prostate cancer's growth is initially influenced by the presence of testosterone. If testosterone is removed by castration, the cancer will often shrink for some period of time before the remaining fraction of testosterone-independent cancer cells grow.

This gentleman was not interested in castration and asked if there was another way to treat this. He was treated was a single shot of a drug which is slowly released into the body over a three month time period. Within that time the patient noticed marked relief in his pain.

• What is the diagnosis of this gentleman?
• Why would the scan show bone abnormalities?
• Which endocrine organs are responsible for serum (blood) calcium levels?
• Describe a mechanism by which a drug could act on the anterior pituitary to lower the testosterone level in the human body.