You have accidentally mixed a bunch of amino acids (tryptophan, tyrosine, alanine, selenocysteine, proline, arginine) together and once your boss finds out, you will be fired on the spot. Your only hope of saving your job is to separate them before anyone finds out. You decide that the only viable option is to use ion exchange chromatography. Explain, in detail, how you would do this?

Using a cation exchange resin, a mixture of four amino acids, Asp (pKa 3.9), Arg (pKa 12.5), Ser (pKa 13) and Lys(pKa 10.5) are separated using an elution gradient of increasing NaCl solution. What would be the correct elution sequence? Explain your reasoning. Draw the chromatogram would look like for this mixture if there was twice as much Asp and Arg in the sample than Ser and Lys.

Why does mRNA have to be processed in eukaryotes and what does involve?

What translates the DNA message and how? Explain what tRNA does. How is it possible to have 45 tRNA but 61 mRNA to code for the same amino acids?

Explain how a ribosome works to generate a protein. Be sure to start with 2 ribosomal subunits coming together, and include the A,P,E sites in your explanation.

1) How many amino acids long is the protein with the following sequence?

5’ tctaaaatgtcagatgtaaagtgcacatcagtagtcttactctcagttttgtaacaactc 3’

3’ agattttacagtctacatttcacgtgtagtcatcagaatgagagtcaaaacattgttgag 5’

2) Design a set of 6 base pair long primers that scientists could use to amplify the entire sequence of the gene in Q1

3) T/F. A base pair substitution (ie. a point mutation) that introduces a nonsense mutation could be introduced to the sequence encoding the protein in Q1.

1) A. Myosin proteins (which are anions) appear in Jessica's urine. Tell why this is problematic and defend your answer by explaining the mechanism for the protein excretion.

B. In addition to a considerable amount of amino acids and myosin in her urine, Jessica also notices she’s thirstier and has higher urine volume than usual. Describe how her urinary abnormalities could cause this increase in water excretion.

1. After being produced in the endoplasmic reticulum, some proteins go on to the __________ where they may undergo final modifications before being packaged to be sent along to their final destination inside or outside of the cell.

2. The cell membrane allows some molecules, such as oxygen and carbon dioxide to pass through, while preventing other molecules such as glucose and amino acids from passing through, this means cell membranes are ______________.

1. You have eaten a meal. The meal went into the digestive tract and was broken down into sugar, amino acids, and fatty acids. You absorbed the nutrients into the blood stream. The nutrients are absorbed from the part of the digestive tract with this function and then transported to the right little finger.

Once in the right little finger, the nutrients enter the cell. Due to cellular respiration (breakdown of fuel for energy), the metabolites of water and carbon dioxide are produced. The carbon dioxide will be exhaled, while the water will be excreted as urine.

List the pathways for

1. The nutrients in the blood to get to the left little finger.
2. The carbon dioxide to get from the left little finger to exhalation.
3. The water molecule to get from the left little finger until it is excreted as urine.

You have been chosen for a very competitive undergraduate clinical internship at St. Visintainer’s Hospital and Metabolic Clinic working with Dr. Saccharo, an expert in enzyme deficiency disorders related to glycolysis. Before your first day Dr. Saccharo has asked that you review the reactions of glycolysis and the concept of isoenzymes.

Recall that isoenzymes are groups of enzymes that catalyze the same reaction in that they use the same reactants to product the same products. They may have different genes, tissue expression, developmental timing of expression, and affinities for their substrates. As an example, phosphofructokinase-1 has 3 isoenzyme forms: PFK-L is expressed in the liver and the gene is found on chromosome 21; PFK-M is expressed in the muscle and the gene is found on chromosome 12; and PFK-P is expressed in platelets and the gene is found on chromosome 10.

Question 1:

If a person would be deficient in all 3 forms of PFK-1, this person would                  .

A.           Have lower than normal glycogen stores.

B.           Have more mitochondrial activity than normal.

C.           Be dead.

D.          Produce more energy per glucose molecule because glycolysis would be unregulated.

It is now Monday morning and you are ready to start seeing patients with Dr. Saccharo.

Patient 1:

Ann is a teenager and avid golfer who was referred to the clinic after being refused at the blood drive and tiring easily on the high school golf course during practice. Ann is examined and a blood sample was obtained for analysis of a glycolysis related metabolic panel. The results of her panel is below (levels: + = normal, - = decreased; ++= increased):

Question 2:

Assuming that Dr. Saccharo is correctly assuming that Ann has a defect in glycolysis, what glycolytic enzyme is the most likely to have the defect based on the blood metabolic profile?

A.           Hexokinase

B.           Phosphofructokinase

C.           Triose Phosphate Isomerase

D.          Pyruvate Kinase

E.           Aldolase

Patient 2:

Marie is a 32-year-old mother of three complaining of fatigue and muscle cramps with exercise. She had always blamed her intolerance to exercise on her sedentary lifestyle. However, she recently joined a gym and after a week of aerobics classes went to her physician, who ordered a series of blood tests. The blood work came back with abnormal results, leading to her muscle biopsy and referral to the metabolic clinic. Marie’s blood was subjected to the same metabolic panel used before with the following results:

Marie’s muscle biopsy was also analyzed and showed an excess of glycogen.

Question 3:

What is the most likely enzyme deficiency for Marie?

A.           Hexokinase

B.           Phosphofructokinase

C.           Triose Phosphate Isomerase

D.          Pyruvate Kinase

E.           Aldolase

Question 4:

If you wanted to test the ability of red blood cells to complete glycolysis what compound would you try to detect?

A.           Fructose-6-phosphate

B.           Aldolase

C.           Pyruvate

D.          Phosphofructokinase

E.           Dihydroxyacetone phosphate

Question 5:

If you used a sample of Marie’s blood for this, what compound could you add to enable these cells to complete glycolysis?

A.           Glucose

B.           Fructose-1,6-bisphosphate

C.           Insulin

D.          Glucagon

E.           Fructose-6-phosphate

1. Another highly regulated enzyme in glycolysis is phosphofructokinase (PFK1). There is evidence from some tumors that PFK1 undergoes a posttranslational proteolysis that yields a truncated functional enzyme (47 kD vs 85 kD) that is insensitive to citrate and ATP. How might this work and why would it be beneficial for a tumor cell?
2. Several isoforms of pyruvate kinase (PK) exist, including PK-M2 which exists mainly in embryonic and adult stem cells. PK-M2 has also been found in many tumor cells, but is in an inactive state. Explain why this seemingly counter-intuitive discovery is actually a benefit for tumor cells.
3. What is the normal function of pyruvate dehydrogenase kinase (PDK)?
4. PDK is more active in cancer cells than regular cells due to the presence of the HIF-1a transcription factor. Why is increased activity of PDK beneficial to cancer cells?