4. Suppose a company wants to find the determinants of job satisfaction for its employees. The company gathers some anonymous data from its employees and runs a regression with Job Satisfaction (on a 1 to 10 scale) as the response variable, and it gets the following results.
ANOVA
|
df |
SS |
|
|
Regression |
4 |
9283 |
|
Residual |
14 |
370 |
(a) What are the null and alternative hypotheses (regarding the b values) for the F-test for the regression?
(b) What is the F-statistic for this regression
(c) The critical F* for the test is 5.04. Do we reject or not reject the null hypothesis in this case?
Why?
(d) What percentage of the variation in Job Satisfaction is “explained” by this regression?
In: Math
While exploring a castle, Exena the Exterminator is spotted by a dragon who chases her down a hallway. Exena runs into a room and attempts to swing the heavy door shut before the dragon gets her. The door is initially perpendicular to the wall, so it must be turned through 90∘ to close. The door has a height of 3.00 m and a width of 1.15 m , and its weight is 720 N . You can ignore the friction at the hinges.
If Exena applies a force of 250 N at the edge of the door and perpendicular to it, how much time does it take her to close the door?
Use 9.80 m/s2 for the acceleration due to gravity.
In: Physics
true or false (with explanation)
a. according to the Fisher effect, when the inflation rate rises, the nominal interest rate rises by the same amount so that the real interest rate remains the same.
b. Inflation make them poorer because it raises the cost of what they buy.
c. the principle of monetary neutrality asserts that changes in the quantity of money influence nominal variables but not real variables in short run.
d. If an economy always has inflation of 10 percent per Year there is an inflation cost that will not suffer.
e. Hyperinflations occur when the goverment runs a large budget deficit, which the central bank finances with a substantial monetary contraction.
In: Economics
Biologists use a sequence of the letters A, C, T, and G to model a genome. A gene is a substring of a genome that starts after a triplet ATG and ends before a triplet TAG, TAA, or TGA. Furthermore, the length of a gene string is a multiple of 3, and the gene does not contain any of the triplets ATG, TAG, TAA, or TGA. Write a program that prompts the user to enter a genome and displays all genes in the genome. If no gene is found in the input sequence, display “no gene is found”. use a for loop and string to create this program.
Here are the sample runs:
Enter a genome string:
TTATGTTTTAAGGATGGGGCGTTAGTT
TTT
GGGCGT
Enter a genome string:
TGTGTGTATAT
no gene is found
In: Computer Science
(My Name is TT please I need new and unique answers, please. (Use your own words, don't copy and paste), Please Use your keyboard (Don't use handwriting)
((Thank you FOR YOUR HELP))
SUBJECT: System analysis and design IT243
Q1:
As the project sponsor, you suggested that your company
that runs multiple local supermarkets should provide an online
shopping service to increase sales during COVID-19 pandemic. Write
a system request to propose this project.
System request
Project Sponsor
Business Need
Business Requirements
Business Value
Special Issues or Constraints
In: Computer Science
(My Name is NN please I need new and unique answers, please. (Use your own words, don't copy and paste), Please Use your keyboard (Don't use handwriting)
((Thank you FOR YOUR HELP))
SUBJECT: System analysis and design IT243
Q1:
As the project sponsor, you suggested that your company
that runs multiple local supermarkets should provide an online
shopping service to increase sales during COVID-19 pandemic. Write
a system request to propose this project.
System request
Project Sponsor
Business Need
Business Requirements
Business Value
Special Issues or Constraints
In: Computer Science
rob has a pension plan and will receive a pension annuity of $19,000 for 19 years starting next year. After 19 payments, the following year (t=20) she receives $10,000, which will then grow at 4% per year thereafter. His life expectancy from today is 40 years (he will receive 40 total payments). The interest rate is 8%. What are these two annuity payments worth today?
In: Finance
Write a program that utilizes a Professor class. A professor has a first name, last name, affiliation, easiness grade, and a helpfulness grade. Grades range from 1 (lowest) to 5 (highest). The Professor class has two constructors. The first constructor initiates the object with just the first name, the last name, and the affiliation. The default value for easiness and helpfulness grade is 3. The second constructor initiates the object using the first name, the last name, the affiliation, and two grades.
The Professor class must not allow a first name or last name to be changed after instantiation.
The affiliation should be implemented as a property.
The grades should have both an accessor method and a mutator method. The Professor class should have a display method that prints all member variables in an appropriate format. For example, you can print out the first name, the last name, affiliation, and the two grades from the display method.
The Professor class should have a ToString() method. Make sure to override the ToString() method to present something meaningful.
Lastly, you should use the Main() method to demonstrate how the Professor class works. For example, create an instance of the Professor class with one of its two constructors. And then, invoke the display method on the instance.
Were using Visual Studios C# console.
This is the program requirements we are working on.
Can you write comments that explain the steps? Or how you get
the result for the steps you write.
In: Computer Science
You are choosing between two projects. The cash flows for the projects are given in the following table ($ million):
|
Project |
Year 0 |
Year 1 |
Year 2 |
Year 3 |
Year 4 |
|
A |
−$52 |
$27 |
$19 |
$18 |
$17 |
|
B |
−$101 |
$19 |
$40 |
$51 |
$58 |
a. What are the IRRs of the two projects?
b. If your discount rate is 5.4%, what are the NPVs of the two projects?
c. Why do IRR and NPV rank the two projects differently?
a. What are the IRRs of the two projects?
(Round to one decimal place.)
In: Finance
|
Imagine that you own a sandwich shop and you have 2 employees. For this exercise, develop the operating portion of a master budget. You need to create seven independent budgets and a budgeted income statement: No. 1 sales budget No. 2 production budget, No. 3 direct materials budget No. 4 direct labor budget No. 5 manufacturing overhead budget No. 6 selling No. 7 administrative expense budget No. 8 budgeted income statement |
In: Accounting