1. Give examples of three important types of chemical reactions that occur in biochemical systems.

2. How is a standard thermodynamic state defined for biochemical systems?

3. Explain what is meant by a term "substrate cycle."

4. What is the critical limitation for formation of carbon-carbon bonds in biochemical systems?

5. Explain why most fatty acids within the body have an even number of carbon atoms.

6. List three vital functions served by amino acids in the body.

1.The novel coronavirus, SARS-Cov2, which is responsible for the disease Covid-19 is a positive strand RNA ((+)ssRNA) virus. From what you learned in BIOL1020, suggest a model of how the SARS-Cov2 genome is replicated. The key enzyme for viral replication is unique to the virus and not found in the human host. What is the name of the enzyme, what is its enzymatic function, and how would you explain that a drug called Remdesivir (an adenosine analogue that causes premature termination of RNA synthesis) is currently the most promising drug against a range of RNA viruses, including Ebola ((-)ssRNA virus), MERS ( (+)ssRNA virus ) and SARS-Cov2 ((+)ssRNA virus)?

2.A mutant E. coli strain is found with a mutation affecting some of its tRNA(Cys). The wild type normally produces a tRNA that recognizes the codon 5’ UGC 3’, and is charged with the amino acid Cysteine (Cys) (its notation is tRNA(Cys)). The mutant tRNA is still charged with Cysteine, but the mutation is in its anticodon that now has the sequence 5’- UCA-3’. How will some of the proteins produced in these E. coli cells be different from the proteins produced in the wild type cells?

The following is a portion of the non-template DNA sequence from the human ras gene. Answer the following questions about this gene and the effects of gene changes to the specified mutant sequence (mutation in BOLD).

Normal human ras: 5’-acatgactgaatataaacttgtggtagttggagctggt-3’

Mutant human ras: 5’-acatgactgaacataaacttgtggtagttggagctggt-3’

a. (4) What is the normal human Ras amino acid sequence from this portion of the gene, starting with the first start codon?

b. (2) Which amino acid from the normal sequence is mutated, and what is the amino acid changed to in the mutant sequence?

c. (3) What type of mutation is present in this gene (nonsense, missense, silent, transition, transversion)? Include all of the listed terms that apply.

d. (1) Is ras a proto-oncogene or a tumor suppressor gene?

e. (3) Describe the normal cellular function of Ras. How might a mutation in ras promote cancer formation, based on this normal cellular function described in your textbook?

Phosphofructokinase is an enzyme that controls the rate of glycolysis. The activity of PFK happens in allosteric regulation by several molecules. Which of the following specific allosteric regulator or regulators would most likely be bound to PFK in yeast cells that are growing in anaerobic conditions?

1. citrate as an allosteric inhibitor

2. ADP as an allosteric inhibitor

3. citrate as an allosteric activator

4. ADP as an allosteric activator

5 AMP as an allosteric activator

6. ATP as an allosteric inhibitor

7 AMP as an allosteric inhibitor

8. ATP as an allosteric activator

During the metabolism of amino acids, amino groups are often switched from one organic compound to another through a process called transamination. The following are two examples of transamination reactions with their corresponding free energy changes:

glutamate + pyruvate ---> α-ketoglutarate + alanine              ∆G^o' = - 1.00 kJ/mol

glutamate + oxaloacetate ---> α-ketoglutarate + aspartate      ∆G^o' = - 4.81 kJ/mol

Answer the following questions about transamination.

a. Using the two equations given above, write an equation for the net formation of alanine and oxaloacetate from aspartate and pyruvate.

b. Calculate the standard free energy change for this overall reaction and indicate whether it will go spontaneously in the direction indicated.

c. Suppose that under steady state conditions in a cell at 37 ^oC, the actual concentrations of pyruvate and aspartate are 1.2 x 10^-2 M, the concentration of alanine is 1.5 x 10^-4 M, and the concentration of oxaloacetate is 1.9 x 10^-5 M. Using the equation that ∆G = ∆G^o' + RT ln [products]/[reactants] and the gas constant of R = 8.315 J/mol K, calculate the actual free energy change and determine if the reaction is spontaneous

Recent evidence suggests that certain Gram positive bacteria communicate using a small peptide called Nisin. The peptide is 8 amino acids long. The Shine Dalgarno sequence used by this bacterium located is AGGAGGU and is located approximately 5 nucleotides away (upstream) of the start codon of the ORF. Below is one strand of DNA corresponding to a region on the bacterial chromosome which contains the ORF for nisin.

5’ GGTCGTGCTGGGTTGAGAAATGCCTACGTGCTGCTAGTTGGGAGCTCCATAGGGGACCTCCTGGGT 3’

You desire to clone this gene and express Nisin as a fusion with an N-terminal His Tag for protein purification and decide to use the expression vector depicted below. You are a new researcher in the department, and since funding is scarce, you have access to only the following restriction enzymes:

SacI, SalI, XhoI, NcoI

Question 1: ( /2)

What is the amino acid sequence of native Nisin? (Include amino (N) and carboxy (C) termini, express using three letter codes).

____________________________________________

Question 2: Design two primers (one forward and one reverse) which you would use to amplify your gene using PCR, and subsequently clone it directionally into the pET28 vector whose map is provided. Each primer should be exactly 15 nucleotides in size in TOTAL. Be sure to indicate 5’ and 3’ ends.

Primer 1: ( /2) ____________________________________

Primer 2: ( /2) ____________________________________

Question 3: Unfortunately, your attempt to purify the fusion protein failed. You suspect that it may be due to the fact that the N-terminal fusion is causing problems for the protein to fold correctly. You decide to make a C-terminal fusion. Design two primers (one forward and one reverse) which you would use to amplify your gene using PCR. You would like to add the least amount of any additional amino acids as possible your fusion protein. Each primer should be exactly 15 nucleotides in size in TOTAL. Be sure to indicate 5’ and 3’ ends.

Primer 1: ( /2) ____________________________________

Primer 2: ( /2) ____________________________________

Question 4:

Unfortunately, you are STILL having no success in detecting your fusion protein after using affinity chromatography! What a nightmare! You want to determine if the inability to isolate your N-terminal fusion protein is due to a failure to clone your gene, if it’s due to transcription failure, or due to translation inefficiency.

a) Is there a single enzyme in your toolkit which would digest your pET28 vector and your pET-nisin recombinant vector a different number of times? If yes, which would it be and how many fragments, assuming perfect resolution, would you expect to see after performing gel electrophoresis on each sample? (2)

Enzyme:

PET28 vector result:

PET28-nisin recombinant vector result:

b) Describe a molecular biology technique which you can use in order to determine if your C-terminal fusion gene is being transcribed properly. You can have access to any reagents (1)

c) Describe a molecular biology technique which you can use in order to determine if your C-terminal fusion protein is indeed being translated. You can have access to any reagents. (1)

Consider the mechanism of cleavage catalyzed by the enzyme aldolase. What would be the products of the reaction if aldolase used glucose-6-phosphate as the substrate, instead of fructose-1,6-bisphosphate (show the structures of glucose-6-phosphate and its products)? Based on your answer, suggest a possible rationale for why nature chose to include two extra steps prior to the aldolase step in glycolysis.

escribe the central dogma theory and explain in detail the two main processes that are involved. Is this theory held true for all genes? Why or why not? Include: transcription, translation, mRNA, tRNA, rRNA, ribosomes, amino acids, coding strand, template strand, RNA polymerase

Transmembrane proteins are usually alpha helices because the polar groups in the backbone make hydrogen bonds with each other. If the transmembrane protein were to have 20 polar amino acids crossing through a polar lipid bilayer, how would the structure of the transmembrane protein be?