Why are the most abundant elements found in our bodies not the most abundant elements found in Earth's crust? (e.g., What characteristics of the most abundant elements in our bodies make them suitable for life?)

How do the structures of carbohydrates, lipids, proteins (structural and enzymatic), and nucleic acids relate to their functions? Include in your discussion a brief description of the structure of each type of molecule.

Identify the level of measurement (nominal, ordinal, interval or ratio) that is most appropriate:

a.) Ratings in Zagat’s Guide for Boston eateries __________________________________

b.) Altitudes above sea level of Himalayan peaks _________________________________________

c.) Temperature readings in Celsius of arboreal canopies __________________________

d.) Types of nucleic acids found in genetic material _____________________________________

e.) Years that assassinations of world leaders occurred   ________________________________

f.) Temperature readings in Fahrenheit of nuclear reactor cores _______________________________

In which of the three major macromolecules would you find hydrocarbons?

Which functional groups would you find in different types of macromolecules? (Hydroxyl, Carbonyl, Carboxyl, Amino, Sulfhydryl, Phosphate, and Methyl groups)

How does carbon organization vary in fructose compared to glucose monosaccharides? What type of reaction forms the glycosidic linkage in a disaccharide like sucrose?

Please give explanations thank you!

which of the following statements about the charge distribution on the amino acid glutamate is incorrect ?

glutamate has three different ionizable groups

at a very low pH, the most abundant form of glutamate will have net charge of +1

at a very high pH the most abundant form of glutamate will have a net charge of -2

at a pH of aprox. 3.2 glutamate will not contain any charged groups

all of the above are correct

1. Mutations are _________.

• changes in the composition of a DNA molecule
• changes in genes that ultimately cause genetic diversity
• the source of new alleles
• chemical changes in the genetic material
• all of the above

2. Using a translation table, transcribe and translate the following DNA template strand:

DNA template               TACGCATTGGAAAGCATC   

Messenger RNA _______________________________

Amino acid sequence ________________________________

3. Briefly describe the role of the following RNA molecules in translation.

mRNA, tRNA, rRNA

Can you find any mutation, name the domains, if the proteins are conserved, and the amino acid sequences and in which organelle will you find the genetic material that encodes your genes.

>Pseudo-nitzschia multiseries (the homolog of the osteroccus tauri)

ATGTCTCAATCTGTATCAGAACGGACTCGAATTAAAAGTGACCGTTACGAATCTGGTGTAATCCCTTACG

CTAAAATGGGTTACTGGGATGCTTCATACACAGTAAAAACTACTGATGTTCTTGCTTTATTCCGTATCAC

ACCACAACCAGGCGTAGATCCTGTTGAAGCTGCTGCTGCAGTAGCTGGTGAATCTTCAACAGCAACTTGG

ACAGTTGTATGGACTGATTTATTAACAGCTTGTGATCGTTACCGAGCTAAAGCTTACCGTGTAGATCCAG

TTCCAAATACATCTGATGTTTTCTTTGCTTTCATCGCATACGAATGTGATTTATTCGAAGAAGGTTCTTT

ATCTAACTTAACAGCATCTATTATTGGTAACGTATTCGGTTTCAAAGCTGTATCAGCTTTACGTTTAGAA

GACATGCGTATTCCTCACTCATACTTAAAAACATTCCAAGGTCCTGCAACAGGTATCGTTGTAGAACGTG

AACGTTTAAATAAATATGGTGCTCCTTTATTAGGTGCTACAGTAAAACCAAAATTAGGTTTATCTGGTAA

AAACTACGGTCGTGTAGTATTCGAAGGTTTAAAAGGTGGTTTAGACTTCTTAAAAGATGATGAGAACATT

AACTCTCAACCATTCATGCGTTGGAGAGAGCGTTTCTTAAACTGTATGGAAGGTATTAACCGTGCATCTG

CTGCTACAGGAGAAGTAAAAGGTTCTTACTTAAACGTTACAGCTGCTACTATGGAAGAAGTAATCAAACG

TTGTGAGTACGCTAAAGAAGTAGGTTCTGTTATCGTTATGATCGATTTAGTTATGGGTTATACAGCTATT

CAATCTGCTGCTTACTGGGCTCGTGAAAACGATATGCTTTTACACTTACACCGTGCTGGTAACTCTACAT

ATGCACGTCAAAAAAACCATGGTATTAACTTCCGTGTAATTTGTAAATGGATGCGTATGTCTGGTGTAGA

TCATATCCACGCTGGAACAGTTGTAGGTAAATTAGAAGGTGATCCTTTAATGATTAAAGGTTTCTACGAT

ACTTTACGTTTAACTCATTTAGAAGTTAATTTACCATACGGTATTTTCTTCGAAATGCCTTGGGCTAGTT

TACGTCGTTGTATGCCAGTAGCATCTGGTGGTATTCACTGTGGTCAAATGCACCAATTAATTCACTACTT

AGGTGATGACGTAGTATTACAATTCGGTGGTGGTACAATTGGTCACCCTGATGGTATCCAAGCCGGTGCT

ACAGCTAACCGTGTTGCTTTAGAAGCAATGGTATTAGCTCGTAACGAAGGTGCTGATTTCTTCAGTAACG

AAGTTGGTCCTCAAATCTTACGTAATGCTGCTAAAACATGTGGTCCATTACAAACTGCATTAGATTTATG

GAAAGATATTAGTTTTAACTACACATCTACAGATACAGCTGATTTCGCTGTAACACCAACTGCAAACGTA

TAA

The results for July for Brahms & Sons follow:  

Required:

Prepare a profit variance analysis for Brahms & Sons. ( Do not round intermediate calculations. Indicate the effect of each variance by selecting "F" for favorable, or "U" for unfavorable. If there is no effect, do not select either option.)

Richard, barry and Andrew decided to enter into a partnership agreement as from 1^st July 2018, some of the provisions of which were as follows.

1. Richard to contribute $24000 cash, inventory the fair value of which was $51000, plant and machinery $94320, accounts receivable totalling $15240
2. Barry to contribute $45000 cash and act as manager for the business at an annual salary of $38400 to be allocated to him at the end of each year.
3. Andrew to contribute $19800 cash, land $144000, premises $288000, furniture and fittings $48600, and motor vehicles $37800. A mortgage of $216000 secured over the premises was outstanding and the partnership agreed to assume the mortgage.
4. Profits or losses of the firm to be divided between or borne by Richard, barry and Andrew in the proportion of 2:1:3 respectively.
5. Interest to be allowed at 8% p.a. on the capital contribution by the partners. Interest at 10% p.a. to be charged on partners’ drawings.
6. During the year ended 30 June 2019, the income of the partnership totaled $144960, and the expenses (excluding interest on capital and drawings and Barry’s salary) amounted to $51600.
7. Richard withdrew $14400 on 1 October 2018 and $9600 on 1 January 2019; Barrie withdrew $4800 only on 1 April 2019; Andrew withdrew $12000 on 30 June 2019.

Required

Prepare general journal entries necessary to open the records of the partnership.

Prepare the balance sheet of the partnership immediately after formation.

Prepare a Profit Distribution account for the year ended 30 June 2019.

QUESTION 1

Which of the following substances is most acidic?

2 points   

QUESTION 2

A buffer is a substance that converts: