Why does it make metabolic sense for UTP to inhibit carbamoyl phosphate synthetase II, whereas ATP activates the enzyme?

Why do light-adapted plants have a higher level of glutamine than dark-adapted plants (and how is amino acid metabolism responsible for it)?

A) What amino acid characteristics result in large Rf values?

B) On a silica plate, predict the relative movement of aspartic acid, valine, and serine.

Which amino acid is formed, in the fewest steps, from 3-phosphoglycerate?

a. alanine

b. none of these

c. aspartate

d. glutamate

e. serine

Enzyme

1. Why are covalent bonds between enzyme and substrate so rare? What kind of bonds do they have?

2. What happens when proteins denature? What environment factors can cause enzymes to denature? What is meant by “optimal” environmental conditions for an organism?

3. Draw a graph showing an exergonic reaction. Label-free energy, ∆G (including the sign “+” or “-“), and the activation energy (E_A). Label the potential energy of the products and the reactants. On the same graph show the difference when enzymes are used for the same reaction. Please label the axes, too.

1. The restriction enzyme SauIIIA recognizes the 4 bp sequence GATC, and the "6-cutter" enzyme BamHI recognizes the sequence GGATCC. Digestion of a particular bacteriophage genome produced a total of 160 SauIIIA fragments. Approximately how many BamHI fragments would you expect if:
A) the phage genome has a “G+C” content of 50%?
B) the phage genome is 80% G+C?

2. At least some of the RNA sequences below include significant regions that are self-complementary, and therefore might form secondary structures such as hairpins or stem-loops. For purposes of this problem, you should identify which sequences have any secondary structures that fit the following criteria:

a minimum length of 5 base pairs

only “Watson/Crick” pairings (i.e., A-U or G-C), with NO mismatches or unpaired bases within the helical/paired region

connecting "hairpin" turns or loops that consist of at least 3 unpaired bases.

(Note that these conditions do not always apply to the secondary structures formed by naturally occurring RNA molecules.)

1. The restriction enzyme SauIIIA recognizes the 4 bp sequence GATC, and the "6-cutter" enzyme BamHI recognizes the sequence GGATCC. Digestion of a particular bacteriophage genome produced a total of 160 SauIIIA fragments. Approximately how many BamHI fragments would you expect if:
A) the phage genome has a “G+C” content of 50%?
B) the phage genome is 80% G+C?

2. At least some of the RNA sequences below include significant regions that are self-complementary, and therefore might form secondary structures such as hairpins or stem-loops. For purposes of this problem, you should identify which sequences have any secondary structures that fit the following criteria:

a minimum length of 5 base pairs

only “Watson/Crick” pairings (i.e., A-U or G-C), with NO mismatches or unpaired bases within the helical/paired region

connecting "hairpin" turns or loops that consist of at least 3 unpaired bases.

(Note that these conditions do not always apply to the secondary structures formed by naturally occurring RNA molecules.)

A double-stranded fragment of viral DNA, one of whose strands is shown below, encodes two peptides, called vir-1 and vir-2. Adding this double stranded DNA fragment to an in vitro transcription and translation system yields peptides of 10 residues (vir-1) and 5 residues (vir-2).

5’ AGATCGGATCGTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT 3’

1. Identify the DNA sequence that encodes each peptide
2. Determine the amino acid sequence of each peptide
3. In a mutant viral strain, the T at position 23 has been replaced with a G. Determine the amino acid sequences of the two peptides encoded by the mutant virus.