1) True or False

- K_eq for H₂O is << 1

- ΔG° is the Gibbs free energy of a reaction at equilibrium.

- All energy released from an exothermic reaction is available to do work in the cell.

- A reaction with an equilibrium constant of 2.4x10^-2 proceeds forward spontaneously under standard state conditions

- Enzyme active sites undergo conformational changes in order to bind optimally to their substrates.

- A reaction with a positive ΔG will proceed in a cell as long as it has an enzyme to catalyze the reaction.

Please answer these questions in as long of detail as possible.

Question 1

a) Write the expression used to calculate rate of digestion as it’s related to starch concentration and time:

b) Explain what a catalytic process is and how it is different from the non-catalytic version of the process. Give an example of an enzymatic process other than amylase and describe the substrate(s)/product(s):

c) Describe what the enzyme amylase does and what would happen in the absence of this enzyme:

1 mL of a 5.0 nM enzyme solution is rapidly mixed into 9 mL of a 0.50 µM substrate solution, and the rate of formation of product is found to be 0.490 µM/s.

a) What are the initial concentrations of enzyme and substrate in the 10 mL mixture?

b) Calculate the Michaelis constant of the complex (KM), knowing that the rate of formation of product saturates to 0.670 µM/s when the experiment is performed with a highly concentrated substrate solution instead of the 0.50 µM substrate solution

Which amino acidand artificialsweetener areverydangerous to some people? Why?

(Hint: Name and describethe disorder, it symptomology, and maintenance)

1.What is the role of histone acetylation in eukaryotic cells?

2.What is the role of amino-acyl-tRNA-synthetases?

What volume (in milliliters) of 0.120 M NaOH should be added to a 0.125 L solution of 0.0250 M glycine hydrochloride (pKa1 = 2.350, pKa2 = 9.778) to adjust the pH to 2.96?

A 65.0 mL solution of 0.161 M potassium alaninate (H2NC2H5CO2K) is titrated with 0.161 M HCl. The pKa values for the amino acid alanine are 2.344 (pKa1) and 9.868 (pKa2), which correspond to the carboxylic acid and amino groups, respectively.a) Calculate the pH at the first equivalence point.b) Calculate the pH at the second equivalence point.

You are given a piece of eukaryotic DNA which is shown below                /6 marks

^5’- CACTCACCCGATTTTTGAATGGCCCTGATGAATCTCTGGTAA -^3’

a)  If this is the coding strand, what is the mRNA produced (label both the 3’ and 5’ ends)?

b)  If this is the template strand, what is the mRNA produced (label both the 3’ and 5’ ends)?

c)  Assuming that the DNA sequence above is the coding strand, predict the amino-acid sequence of the protein produced from the piece of mRNA using single letter codes. In your answer denote both the amino and carboxy ends of the protein.

6. The following sequences are mutations of the template sequence in question 1. For each mutated sequence, indicate the new amino acid sequence produced and the type of mutation that is the end result in the amino acid (frameshift, Missense, nonsense, silent) as well as the type of mutation that occurred in the DNA sequence (substitution, addition, deletion)

Template sequence question 1: 3’ TACCCTGGTGGTTTGCGGACT 5’

a. 3’ TAC CCG GTG GTT TGC GGACT 5’

b. 3’ TAC ACT GGTGGTTTGCGGACT 5’

c. 3’ TAC CCTGGTGGTATGCGGACT 5’

Which of these are involved during the direct synthesis of a protein? a. mRNA, small ribosomal subunit, amino acid b. tRNA, large ribosomal subunit c. RNA polymerase, transcription factors d. a and b e. all of these

1. During protein translation, the codon on the mRNA matches to the complementary ____ .

   		codon on the amino acid
   		triplet on the DNA
   		anticodon on the tRNA
   		slot in the ribosome
   		trio on the polypeptide

1. During the electron transport chain, each protein is first ____ and then ____ .

   		reduced; oxidized
   		oxidized; reduced
   		phosphorylated; reduced
   		reduced; phosphorylated
   		oxidized; hydrogenated

Identify one aspect of translation that is present in Bacteria but absent in Eukarya: Group of answer choices :

rRNA in the large subunit of the ribosome plays a catalytic role

The elongation stage is sensitive to the presence of diphtheria toxin

The genetic code consists of 64 unique 3-nucleotide codons

A peptide bond forms between the amino acid of one amino-acylated tRNA and a peptide on the other tRNA

An tRNA carrying methionine is recruited to the ribosome to form the initiation complex

The small subunit rRNA molecule anneals to the Shine-Dalgarno sequence on the mRNA