. List the functions of the hormones/enzyme listed below:
• Aldosterone
• Renin
• Antidiuretic Hormone (ADH)
In: Anatomy and Physiology
Which of the following statements about enzyme mechanism reaction steps are true (select all that apply)?
|
On a reaction coordinate diagram, a reversible step is indicated by reactant and product at similar energy |
||
|
Irreversible steps are important in enzyme mechanisms to help ensure enzymes catalyze reactions in the desired direction |
||
|
Substrate binding is usually an irreversible step |
||
|
Irreversible steps of a reaction mechanism are always very slow |
||
|
To determine if a step is reversible or irreversible, it is necessary to know the activation energy of the step |
In: Chemistry
1) True or False
- Keq for H2O is << 1
- ΔG° is the Gibbs free energy of a reaction at equilibrium.
- All energy released from an exothermic reaction is available to do work in the cell.
- A reaction with an equilibrium constant of 2.4x10-2 proceeds forward spontaneously under standard state conditions
- Enzyme active sites undergo conformational changes in order to bind optimally to their substrates.
- A reaction with a positive ΔG will proceed in a cell as long as it has an enzyme to catalyze the reaction.
In: Biology
Please answer these questions in as long of detail as possible.
Question 1
a) Write the expression used to calculate rate of digestion as it’s related to starch concentration and time:
b) Explain what a catalytic process is and how it is different from the non-catalytic version of the process. Give an example of an enzymatic process other than amylase and describe the substrate(s)/product(s):
c) Describe what the enzyme amylase does and what would happen in the absence of this enzyme:
In: Biology
1 mL of a 5.0 nM enzyme solution is rapidly mixed into 9 mL of a 0.50 µM substrate solution, and the rate of formation of product is found to be 0.490 µM/s.
a) What are the initial concentrations of enzyme and substrate in the 10 mL mixture?
b) Calculate the Michaelis constant of the complex (KM), knowing that the rate of formation of product saturates to 0.670 µM/s when the experiment is performed with a highly concentrated substrate solution instead of the 0.50 µM substrate solution
In: Other
Which amino acidand artificialsweetener areverydangerous to some people? Why?
(Hint: Name and describethe disorder, it symptomology, and maintenance)
In: Chemistry
1.What is the role of histone acetylation in eukaryotic cells?
2.What is the role of amino-acyl-tRNA-synthetases?
In: Biology
What volume (in milliliters) of 0.120 M NaOH should be added to a 0.125 L solution of 0.0250 M glycine hydrochloride (pKa1 = 2.350, pKa2 = 9.778) to adjust the pH to 2.96?
A 65.0 mL solution of 0.161 M potassium alaninate (H2NC2H5CO2K) is titrated with 0.161 M HCl. The pKa values for the amino acid alanine are 2.344 (pKa1) and 9.868 (pKa2), which correspond to the carboxylic acid and amino groups, respectively.a) Calculate the pH at the first equivalence point.b) Calculate the pH at the second equivalence point.
In: Chemistry
You are given a piece of eukaryotic DNA which is shown below /6 marks
5’- CACTCACCCGATTTTTGAATGGCCCTGATGAATCTCTGGTAA -3’
a) If this is the coding strand, what is the mRNA produced (label both the 3’ and 5’ ends)?
b) If this is the template strand, what is the mRNA produced (label both the 3’ and 5’ ends)?
c) Assuming that the DNA sequence above is the coding strand, predict the amino-acid sequence of the protein produced from the piece of mRNA using single letter codes. In your answer denote both the amino and carboxy ends of the protein.
In: Biology
6. The following sequences are mutations of the template sequence in question 1. For each mutated sequence, indicate the new amino acid sequence produced and the type of mutation that is the end result in the amino acid (frameshift, Missense, nonsense, silent) as well as the type of mutation that occurred in the DNA sequence (substitution, addition, deletion)
Template sequence question 1: 3’ TACCCTGGTGGTTTGCGGACT 5’
a. 3’ TAC CCG GTG GTT TGC GGACT 5’
b. 3’ TAC ACT GGTGGTTTGCGGACT 5’
c. 3’ TAC CCTGGTGGTATGCGGACT 5’
In: Biology