>cDNA
TTGCTCTTACTTCCGGTTCGCAGCGTACAGTTAAGAAGAGCAAGCACGATACGCCGCCAAGGTGGCCTCA GTCGACTAGCAATGCAGCTCGTGCCGCGAGAGATCGATAAACTGACCATCTCTAATCTGGGATTTCTGGC CCAGCGGAGATTGGCCCGGGGAGTGAGGTTGAATCATGCAGAAGCGACTGCGTTGATCGCATCCAATCTC CAAGAGCTTATTCGAGATGGCAACAATTCGGTGGCAGATCTCATGACGATCGGCAAGGAGATGCTTGGAC GTCGACATGTCCTACCCTCTGTCGTGGCCACCTTGAAACAAGTTCAAGTTGAAGGAACTTTTCCCACTGG GACGAACCTGATCACCGTGGTCAATCCCGTTTGTTCGGATGATGGCGACCTGGAGAAAGCCCTCTACGGA AGCTTTTTGCCTGTGCCGCCGAAAGAAACGTTCCCGGATCCTGATCCGGATGACTATCAGCCAGAGAAGA TGCCTGGCGCTGTGATACCCCTCAAAACGAGCAAGAAAATTGAGCTCAATGCCGGGAGAAATAGAATTAT GCTTAAAGTGACAAGTCGAGGAGACCGGCCCATTCAGGTTGGTTCACACTATCATTTTATAGAGGTGAAT CCACAATTGGACTTCGACCGTGCGAAGGCGTACGGATATCGCCTTGACATCCCAGCTGGGACGTCTATCC GCTTTGAACCCGGTGCTACCAAGGCAATCCCGCTCGTCGAAATTGGCGGCAAGAGAATCATTCGAGGGGG CAACCACATCGCCGTTGGGCAGGTGGATTTCCGAAGAGTTGATGAAATCATCATGCGTCTGCAAAAAGCT GGATTTGCGTATACTCCGGAGCCTAAACAGGATGCTCATTTGATCGAGCCATTTTCAATGACGCGGGAAG CATATGCTCGCATGTTTGGTCCTACCACTGGAGATGTAGTCAAGCTAGGAACCACAGATTTGTGGATTAA AGTCGAAAAGGACCTGACCTACTACGGTGACGAATGTTCATTCGGTGGTGGCAAGACCATAAGAGACGGG ATGGGGCAAGCTACAGGAAGGCATTCCGTGGATGTCCTGGATACAGTCCTGGTGAACGCGCTAATTGTCG ATTGGACGGGTATTTACAAGGCTGATATTGGACTAAAAGATGGAATGATCTGCGGAATCGGCAAAGCTGG AAACCCAGACGTGATGGATGGTGTCACCCCCAATATGATAGTTGGCTCTTCGACAGATGTTATCGCATGT GAAGGAAAAATTGTCACTGCAGGAGGAATTGACACACACGTCCATTTTATATGCCCACAGCAGGTCGAGG AAGCCCTCGCCTCCGGAGTCACGACTCTTCTCGGTGGCGGCACCGGTCCAACTGAGGGAACAAATGCGAC TACATGCACACCGGCTCCAAATCAATTCAAGACGATGATGCAGGCTTGTGATCATCTTCCAATAAACGTT GGCCTTACAGGCAAAGGTAATGACAGCGGTCTTCCATCTCTGAGGGATCAATGCCGTGCAGGAGCCGCCG GCTTGAAGGTGCATGAAGATTGGGGTGCAACGCCGGCTGTCATTGATACATGCCTCCAGGTCTGCGACGA GTTCGATATTCAATGTCTCATCCATACCGACACCCTGAACGAATCTGGCTTCGTTGAACAGACCGTCAAT GCCTTTAAAAATCGAGTGATTCATACGTACCACACTGAGGGTGCTGGAGGAGGCCACGCTCCAGATATCA TATCCGTCGTCGAGAAGCCAAACGTCCTGCCCAGCAGTACGAATCCCACTCGTCCGTATACGGTAAATAC TTTAGATGAACATCTGGACATGGTAATGGTCTGCCATCATTTGTCCAAAGATATTCCTGAAGACGTGGCT TTTGCGGAAAGCCGGATCCGATCCGAGACAATTGCTGCAGAAGACGTTCTTCATGACACGGGAGCCATCA GCATGCTATCCTCGGACTCTCAAGCTATGGGACGCTGTGGAGAAGTTGTTGTCCGGACATGGAACACTGC ACATAAGAATAAAATGGAACGAGGGCGACTCAAGGAGGATGAAGGGACGGATTCTGATAATTTTAGGGTT AAACGGTATATCAGCAAGTACACCATCAACCCTGCCATTGCACAGGGGATGGCCTACACTATTGGGAGCG TGGAAGTTGGCAAGACCGCTGATTTGGTTCTGTGGAAATTCGCCAACTTTGGGACTAAACCGAGTATGGT CTTGAAGTCTGGAATGGCTGTCTCAGCGCAGATGGGTGATCCCAATGGCTCTATCCCCACAATCGAGCCT ATTATTATGAGGCCTATGTACGCTAGTCTTAACCCTAAAGCCTCAATCATGTTCGTATCCCAAGCATCCA TCAAGCTTGGTATCATCGACAGTTACCACCTGAAGAAGCGGATCGAGCCAGTGAAGAATTGTCGGAATAT AAGCAAGAGAGATATGAAATTTAATGATATTATGCCCAAAATGAGAGTCGATCCGGAGAGCTATGTTGTC GAGGCTGACGGGGAAGAGTGTACCGCTGAGCCAGTGTCAGAGTTGCCTTTAACACAAGACTATTTCGTTT ACTGAAAATTGGTGGAGACCATAGAACGTCTCCACAGATTAGTCGTGGAAAAGTAATGCTCATGGCGATA GTATCCTTCTGTACCTCTTTTGATGAATATTAGTACATTTTATTGCATATCTATTCCTTTGGTCCTGTGC GTCTCCACGTGAGCATCCCTTTTTGCTAATCCCCAACGCCCTACAGAGATGGACCATTGACTTATCTGAA ATTCTAAATTCGCAATAAGCTCTCCCAGAAAAACAGTAAGATCACGCGCCCGGAACTCCTTGCTCCCAAA AAAAAAAAGGAATACAACTATTTAAAGCTCTTCATCCATCACAGTATGGTTATTGCCTGCCGAAATGAGC GAGTAGAGAGTCGACCACGTCTCGTGCTTGGCCGCACGATACGCAGAGATCCTTGAATGCATACGTCTTA GCATGGACGCCTTGCGGTCCTGACAACTAGGTGGGAGGGTTGTGGCTTGGGCCGGAT
In: Biology
1. Why is application integration an important part of running an online business?
2. Why would database management software be an important component of an online business Web site’s technology?
3. What is the key function of a content management system as used in an online business?
4. Name four types of information that might be useful inputs to a customer relationship management (CRM) system.
5.Briefly explain why mobile advertising is growing so rapidly.
6.Explain what online text ads are and briefly describe their advantages over online display ads.
7.What is an ad exchange network and how does it differ from a display advertising network?
8. Briefly define and distinguish between emotional and rational branding.
In: Economics
2. Draw an entity relationship diagram (ERD) for the following situation:
The state of Georgia is interested in designing a database that will track its researchers. Information of interest includes researcher name, title, position; university name, location, enrollment; and research interests. Each researcher is associated with only one institution, and each researcher has several research interests.
3. Visit a Web site that allows customers to order a product over the Web (e.g., Amazon.com). Create a data model that the site needs to support its business process. Include entities to show what types of information the site needs. Include attributes to represent the type of information the site uses and creates. Finally, draw relationships, making assumptions about how the entities are related.
In: Computer Science
In this problem, you will research reporting entities for governments in the GASB’s Governmental Accounting Research System (GRS). Access the GRS database citing your results from the GASB guidance with utmost authoritative guidance. Provide requisite examples as requested from the GRS and cite your results from the Codification. Minimum of 2 pages required. Research the accounting issue and formulize your findings in a formal research memo. The formal memo should be in good form with proper grammar, conveying the results of your research.
Define a financial reporting entity. Give an example of a primary government. Define and give an example of a component unit. Explain the two methods of reporting the primary government and component units in the financial reporting entity and when each is required.
In: Accounting
Give an input file of student records in the following format:
<name>#<SID>#<major>#<GPA>
Smith Eugene#A9S65A#Chemistry#2.50
Brown Ezra#T56G0M#Business Administration#1.36
Brown Ferman#PI56T4#Accounting#2.68
Chavis Ertle#7HS56#Chemistry#3.00
Strickland DiChildersa#TWH54F#Business Administration#2.00
Stone Clark#BN78N3W#English#4.00
Childers Evelyn#U8M8N2#Criminal Justice#2.73
Stone Desmond#JHD9K2#Computer Science#3.23
Write a Java application to process the input file of student information. Design your solution using classes for student, student Database, and a driver class. Your application should output the average GPA and display the student list in the descending order of their GPA.
In: Computer Science
Telemedicine
Telemedicine has become progressively important, since there is an increased demand for chronic diseases treatment. Nowadays, with this advance technology, doctors can provide consultations to patients using FaceTime or Skype on mobile devices. Moreover, they are also able to access medical examination reports from database and send prescriptions to patients’ pharmacies, without meeting the patients face to face. However, telemedicine is still at the beginning stage with only $200 million of revenue yearly. According to healthcare experts, they predict telemedicine will increase annual revenue to $2 billion for a few years down the road.
Question 1 [15 marks - NOT more than 200 words] To marketers, what role has mobile technology played in evolution of this industry? Explain.
In: Operations Management
Information is data that is framed in a specific context. In this sense, information is contextual data that has a level of inherent value. Data might be the binary 0s and 1s on a hard drive, but information is the combination of that binary data into a document, media file, or database. Therefore, information systems are methods of managing the value of different types of data. The value of the data might be in the personal records such as social security number, addresses, or shopping habits that are linked together to form an online shopping cart and on-click purchasing. The value of information provides for the potential for ethical, social, and political issues within an organization. An example of these ethical, social, and political issues can be found in the concept of privacy.
What ethical, social, and political issues arise with the use of information systems ?
In: Operations Management
Select a dataset that is publicly available on the Internet, such as the Census Bureau, any government database, any of the databases used in this class or in prior courses to date, or any nonprofit databases that are publicly available.
Using the data set, identify a research question that you want to study. Using the dataset you located, review the type of data that is included in the set. Then, think of a possible research question, using the data provided, that you may want to ask and then research.
Then, use at least 2 variables and an n value of 20 for each variable to run analysis and draw conclusions based on the data. Be sure that you answer your research question in your analysis.
Length: 2-3 pages
identify a research question that you want to study.
In: Computer Science
1.List the four objects provided by the WSH to interact with the computer system using a scripting language:
2.What does the following instruction do?
at 22:00 /every:monday dfrgui.exe
3. What does the following command line statement do?
schtasks /create /?
4.What does the following command line statement do?
schtasks /create /sc daily /tn t1 /tr chkdsk.exe /st 23:45:00
5.What does the following instruction do?
schtasks /delete /tn task3
6. What does the following command prompt instruction do?
move .\*.txt D:\files
7.What does the following command prompt instruction do?
md database management
In: Computer Science
In: Computer Science