Acetylcholine binds to what type of receptor?

a. What does acetylcholinesterase do?

b. What happens if acetylcholinesterase is inhibited (blocked)?

c. Will ACh increase or decrease in the synapse? Increase because once the enzyme is eliminated, Ach will increase in production resulting in more responses

What type of receptors do the following bind to?

a. Epinephrine and norepinephrine

b. Dopamine

c. Serotonin

d. Histamine

i. How does a monoamine oxidase inhibitor work (MAO-I)?

ii. How does a selective serotonin reuptake inhibitor (SSRI) work?

Amino acid messengers:

a. What kind of channel does GABA open? Causes an IPSP or EPSP?

b. What kind of channel does glutamate open? Causes an IPSP or EPSP?

Answer the following questions based on this codingstrand of DNA:                                    

                                    5’ GGCCATGACAGAGGAGCAAAAGTTATTGCT 3’

Drennan et al. (1996) identified several mutations in this enzyme that result in methylmalonic acidemia (MMA). One of those mutations is a C to A at base pair 1904 in the coding strand of DNA (bold and italicized in the template strand).

1. Write the unique coding strand of DNA for this patient and highlight the change you made. Write it 5’ to 3’.
2. Write the mRNA sequence for this patient and clearly highlight the change you made. Write it 5’ to 3’.
3. Write the amino acid sequence for this patient, highlight what differs from the normal (wildtype) sequence.
4. What type of mutation is this? (insertion, deletion, silent, nonsense,missense,or frameshift mutation? Explain your reasoning.

1. The classical point of view is that, during mitochondrial respiration, three ATP molecules can be generated from one molecule of NADH + H⁺ and only two from FADH₂. When factoring in the cytosolic NADH + H⁺, the maximum number of molecules of ATP per glucose generated by the electron transport system is _____.

   	A.	2
   	B.	4
   	C.	36
   	D.	38 47

47.

1. The advantage to the cell of the gradual oxidation of glucose during cellular respiration compared with its combustion to CO₂ and H₂O in a single step is:

   	A.	energy can be extracted in usable amounts.
   	B.	more free energy is released for a given amount of glucose oxidized.
   	C.	no energy is lost as heat.
   	D.	more CO2 is produced for a given amount of glucose oxidized.

48.

1. What purpose does the phosphorylation of glucose to glucose 6-phosphate by the enzyme hexokinase serve as the first step in glycolysis?

   		It helps drive the uptake of glucose from outside the cell.
   		It generates a high-energy phosphate bond.
   		It converts ATP to a more useful form.
   		It enables the glucose 6-phosphate to be recognized by phosphofructokinase, the next enzyme in the glycolytic pathway.

49.

The products of the tricarboxylic acid cycle are:

2. How do warranties and guarantees act as signals? What economic information problem might they address? (p. 457 #2)

Explain how the carbohydrates in the food are digested and in what form they are then absorbed into the bloodstream from the intestine?

Inside the cells, the carbohydrates are degraded in a reaction pathway called glycolysis. What is formed in glycolysis, ie what is the end product?

How many ATPs are formed, in glycolysis, when one glucose molecule is degraded? Are these ATPs formed by phosphorylation at the substrate level or by oxidative phosphorylation? Explain your answer.

If the cell has enough energy, glycolysis can be slowed down by its
speed regulating step. Which step is this, and which metabolite is formed from glucose up to this step?

What can the metabolite, which is formed in the glycolysis up to that
speed regulating step, used in the cell that has enough energy from before?

A single amino acid change in Ras eliminates its ability to hydrolyze GTP even in the presence of a GTPase-activating protein (GAP). Roughly 30% of human cancers have this change in Ras. You have just identified a small molecule that prevents the dimerization of a receptor tyrosine kinase that signals via Ras. Would you expect this molecule to be effective in the treatment of cancers that express this common, mutant form of Ras? Why or why not?

(Please give me a proper detailed explaination)

If a mother had blood type _____, her second baby and subsequent children would be endangered if they had type A+.

Which of the following statements about human blood is false?

Which of the following is not a cause of chronic high blood pressure (hypertension)?

Which of the following statements about cholesterol is false?