6. Distinguish between single step selection and cumulative selection. e.g how long would it take to find the correct sequence of polypeptide that was 100 amino acids long? What is about cumulative selection that makes it so much more efficient at finding the correct sequence? How does the program demonstrating cumulative selection differ from the real process of natural selection? You should be able to come up with at least three differences.

the proteins containing the following amino acids

61 LYS     12 SER      25 MET

22 HIS      75 GLU     56 ILE

29 ARG     45 PRO     83 LEU

77 ASP   67 GLY   26 TYR

24 TR       65 ALA      47 PHE

71 VAL

A) what its net charge at PH 1

b) What is net charge at ph 13

c) calculate the pI?

Which of the following is TRUE?

The hepatic portal vein transports water-soluble vitamins, amino acids and monosaccharides from the small intestine to the liver.

The hepatic portal vein transports lipids from the small intestines to the liver

The lymphatic system transports water-soluble vitamins, amino acids and monosaccharides from the small intestine to the liver

Question 2

Which of the following is TRUE about the stomach?

It contains 3 layers of smooth muscle that contract to mechanically break up food particles and propel food forward by peristalsis

It contains Endocrine glands that secrete Gastrin into the stomach

Small polypeptides are absorbed by endocytosis from the stomach

Question 3

The intestinal phase of digestion _________________________.

Slows gastric emptying to ensure that nutrients entering the small intestine are digested and absorbed.

Stimulates the gastroenteric reflex

Maintains homeostasis of blood pH

Prevents gastroesophageal refulx

Question 4

The interstitial cells of Cajal are _________________________.

Pacesetter cells of the enteric nervous system

Afferent sensory neurons of the enteric nervous system

The extrinsic neurons that innervate the enteric nervous system

Question 5

Which monosaccharide uses secondary active co-transport with sodium (a SGLT) for absorption across the apical membrane of the Small Intestine?

Glucose

Lactose

Sucrose

Maltose

(5) NADH and FADH₂ molecules are processed in the final sub pathway of cellular aerobic respiration. These molecules were described as carriers of _________________.

(A) energy                                                      (B) electrons    

(C) carbon units                                             (D) none of the above

(6) Adenosine triphosphate (A.T.P.) is

(A) energy rich compared with Adenosine diphosphate (A.D.P.)   

(B) energy poor compared with Adenosine diphosphate (A.D.P.)   

(C) not water soluble

(D) not dephosphorylated (that is, removal of a phosphate group) to liberate energy

(7) The pyruvate molecule that is produced in the first sub pathway of cellular aerobic respiration has three fates. In the specific case where a person is exercising vigorously and experiences muscle burn, which of the following molecules is produced?

(A) acetyl-CoA                                              (B) ethanol    

(C) lactic acid                                                (D) none of the above

(8) In your readings, you saw that photosynthesis as a classical example of anabolism. The pathway that is involved in breaking down water (H₂O) to produce molecular oxygen (O₂ is called

(A) the citric acid cycle (the Krebs cycle)     (B) the light dependent reactions    

(C) glycolysis                                               (D) the light independent reactions

(9) Which of the following statements are true with respect to the activity of enzymes?

(A)   they speed up chemical and biochemical reactions

(B)   they lower the “activation energy” of a reaction   

(C)   they are highly specific with respect to the molecules that can be bound to them

(D) all of the above

(10) When the molecule to be modified is bound within the enzyme’s active site, the resulting complex is called the

(A) enzyme-inhibitor complex  

(B) enzyme-activator complex

(C) enzyme-enzyme complex

(D) enzyme-substrate complex

(11) In your readings you saw that each step a metabolic pathway is carried out by an enzyme and that enzymes are highly dependent on their immediate environment to function. Which of the following factors affect enzyme activity?

(A) temperature                                             (B) acid-base balance (pH)    

(C) salt concentration (tonicity)                    (D) all of the above

List the stabilizing forces at tertiary level of protein structure. An enzyme containing the amino aspartic acid (pK_a of the side chain = 3.65) and histidine (pK_a of the side chain= 6) in the active (catalytic ) site has an optimal activity at a pH of 5.0. What is the major stabilizing force at the catalytic site? Using structures and 1-3 complete sentences, predict and explain what is expected to happen to the activity if the pH is increased to 8.

"please answer in details"

Phosphoglycerate kinase is an important enzyme in the glycolysis. The conversion of 1,3-Bisphosphoglycerate reacts under standard conditions with release of 18,8 kJ pr mol. Hydrolysis of adenosine triphosphate is spontaneous under liberation of 30,4 kJ/mol.
a) Write the complete reaction and calculate ΔG’ for the reaction occurring at 37 °C and pH 7, when it is known that the concentration of adenosine triphosphate, adenosine diphosphate, glycerate-3-phosphate and 1,3-bisphosphoglycerate is 1.25mM, 0.1mM, 1.0 mM and 1μM, respectively.
b) Calculate the ratio between glycerate-3-phosphate and 1,3-bisphosphoglycerate at equilibrium.
Use the same temperature, pH and levels of ATP and ADP as given in question a

1. Hers disease results from an absence of liver glycogen phosphorylase. Which of the following is NOT likely to be a symptom of an individual with Hers disease?

2. If the concentration of ATP is low, the availability of glucose and acetyl-CoA is high, and no other metabolic demands are made on the cell, what is the most likely fate of oxaloacetate?

3. Amino acid degradation:

Below is a segment of coding sequence from the overlapping Ink4A-Arflocus (top line) and protein sequence from Ink4A(line 2, zero frame) and Arf(line 3, +2 frame).

caggtcatgatgatgggcagcgcccgagtggcggagctgctgctgctccacggcgcggag

Q  V  M M  M  G  S  A R  V  A  E  L L  L  L  H G  A  E

G  H  D D  G  Q R  P  S G  G  A A  A  A  P  R  R  G

-What bases could be used to maintain this Leucine codon in Ink4A but mutate the Proline codon in Arf?

- What amino acid codons could be introduced into Arf Proline codon without changing the Ink4A Leucine codon?

- What mutant amino acids may be substrates for phosphorylation?

1 (a). Describe one fundamental way in which proteins and DNA resemble one another and one fundamental way in which they differ from one another.

(b). Using the genetic code table provided in lecture (or you can see one here: http://tigger.uic.edu/classes/phys/phys461/phys450/ANJUM02/codon_table.jpg) write the sequence of a mRNA molecule that could encode the following amino acid sequence (for amino acids that are specified by more than one codon, just choose one of the codons; label 5’ and 3’ ends in all figures):

methionine-leucine-valine-lysine-serine-tryptophan-threonine.

(c). Write both strands of the DNA molecule from which this mRNA was transcribed.

(d). Delete the second base of the leucine codon in the mRNA and retranslate your mRNA.

1. Please explain how the sequence of events that occurs when a codon that specifies an amino acid enters a ribosome's A site differs from the sequence of events that occurs when a stop codon enters a ribosome's A site.

2. Below is the base sequence of the template strand of DNA. Please answer the following questions based upon this DNA sequence:

3’–ACTACACGACAGGCATAATT—5’ (DNA Template)

a. What is the base sequence of the non-template (coding) strand of DNA? (1 pt.)
b. In which direction (left or right) would the promoter lie on the template strand? Why? (2 pts.)
c. What is the RNA sequence that would be produced by the template strand? (1 pt.)
d. What would be the sequence of amino acids in the polypeptide produced from the RNA strand from (c)? (2 pts.)