(5) NADH and FADH₂ molecules are processed in the final sub pathway of cellular aerobic respiration. These molecules were described as carriers of _________________.

(A) energy                                                      (B) electrons    

(C) carbon units                                             (D) none of the above

(6) Adenosine triphosphate (A.T.P.) is

(A) energy rich compared with Adenosine diphosphate (A.D.P.)   

(B) energy poor compared with Adenosine diphosphate (A.D.P.)   

(C) not water soluble

(D) not dephosphorylated (that is, removal of a phosphate group) to liberate energy

(7) The pyruvate molecule that is produced in the first sub pathway of cellular aerobic respiration has three fates. In the specific case where a person is exercising vigorously and experiences muscle burn, which of the following molecules is produced?

(A) acetyl-CoA                                              (B) ethanol    

(C) lactic acid                                                (D) none of the above

(8) In your readings, you saw that photosynthesis as a classical example of anabolism. The pathway that is involved in breaking down water (H₂O) to produce molecular oxygen (O₂ is called

(A) the citric acid cycle (the Krebs cycle)     (B) the light dependent reactions    

(C) glycolysis                                               (D) the light independent reactions

(9) Which of the following statements are true with respect to the activity of enzymes?

(A)   they speed up chemical and biochemical reactions

(B)   they lower the “activation energy” of a reaction   

(C)   they are highly specific with respect to the molecules that can be bound to them

(D) all of the above

(10) When the molecule to be modified is bound within the enzyme’s active site, the resulting complex is called the

(A) enzyme-inhibitor complex  

(B) enzyme-activator complex

(C) enzyme-enzyme complex

(D) enzyme-substrate complex

(11) In your readings you saw that each step a metabolic pathway is carried out by an enzyme and that enzymes are highly dependent on their immediate environment to function. Which of the following factors affect enzyme activity?

(A) temperature                                             (B) acid-base balance (pH)    

(C) salt concentration (tonicity)                    (D) all of the above

List the stabilizing forces at tertiary level of protein structure. An enzyme containing the amino aspartic acid (pK_a of the side chain = 3.65) and histidine (pK_a of the side chain= 6) in the active (catalytic ) site has an optimal activity at a pH of 5.0. What is the major stabilizing force at the catalytic site? Using structures and 1-3 complete sentences, predict and explain what is expected to happen to the activity if the pH is increased to 8.

"please answer in details"

Phosphoglycerate kinase is an important enzyme in the glycolysis. The conversion of 1,3-Bisphosphoglycerate reacts under standard conditions with release of 18,8 kJ pr mol. Hydrolysis of adenosine triphosphate is spontaneous under liberation of 30,4 kJ/mol.
a) Write the complete reaction and calculate ΔG’ for the reaction occurring at 37 °C and pH 7, when it is known that the concentration of adenosine triphosphate, adenosine diphosphate, glycerate-3-phosphate and 1,3-bisphosphoglycerate is 1.25mM, 0.1mM, 1.0 mM and 1μM, respectively.
b) Calculate the ratio between glycerate-3-phosphate and 1,3-bisphosphoglycerate at equilibrium.
Use the same temperature, pH and levels of ATP and ADP as given in question a

1. Hers disease results from an absence of liver glycogen phosphorylase. Which of the following is NOT likely to be a symptom of an individual with Hers disease?

2. If the concentration of ATP is low, the availability of glucose and acetyl-CoA is high, and no other metabolic demands are made on the cell, what is the most likely fate of oxaloacetate?

3. Amino acid degradation:

Below is a segment of coding sequence from the overlapping Ink4A-Arflocus (top line) and protein sequence from Ink4A(line 2, zero frame) and Arf(line 3, +2 frame).

caggtcatgatgatgggcagcgcccgagtggcggagctgctgctgctccacggcgcggag

Q  V  M M  M  G  S  A R  V  A  E  L L  L  L  H G  A  E

G  H  D D  G  Q R  P  S G  G  A A  A  A  P  R  R  G

-What bases could be used to maintain this Leucine codon in Ink4A but mutate the Proline codon in Arf?

- What amino acid codons could be introduced into Arf Proline codon without changing the Ink4A Leucine codon?

- What mutant amino acids may be substrates for phosphorylation?

1 (a). Describe one fundamental way in which proteins and DNA resemble one another and one fundamental way in which they differ from one another.

(b). Using the genetic code table provided in lecture (or you can see one here: http://tigger.uic.edu/classes/phys/phys461/phys450/ANJUM02/codon_table.jpg) write the sequence of a mRNA molecule that could encode the following amino acid sequence (for amino acids that are specified by more than one codon, just choose one of the codons; label 5’ and 3’ ends in all figures):

methionine-leucine-valine-lysine-serine-tryptophan-threonine.

(c). Write both strands of the DNA molecule from which this mRNA was transcribed.

(d). Delete the second base of the leucine codon in the mRNA and retranslate your mRNA.

1. Please explain how the sequence of events that occurs when a codon that specifies an amino acid enters a ribosome's A site differs from the sequence of events that occurs when a stop codon enters a ribosome's A site.

2. Below is the base sequence of the template strand of DNA. Please answer the following questions based upon this DNA sequence:

3’–ACTACACGACAGGCATAATT—5’ (DNA Template)

a. What is the base sequence of the non-template (coding) strand of DNA? (1 pt.)
b. In which direction (left or right) would the promoter lie on the template strand? Why? (2 pts.)
c. What is the RNA sequence that would be produced by the template strand? (1 pt.)
d. What would be the sequence of amino acids in the polypeptide produced from the RNA strand from (c)? (2 pts.)




QUESTION 1

1. Muscles can use ketone bodies, glucose, and fatty acids for energy.

   True

   False

1 points   

QUESTION 2

1. Lysine and arginine are the only purely ketogenic amino acids.

   True

   False

1 points   

QUESTION 3

1. Arginine is a precursor for the synthesis of nitric oxide, a free radical gas.

   True

   False

1 points   

QUESTION 4

1. If thrown into a lake, a 10-pound slab of butter would sink to the bottom.

   True

   False

1 points   

QUESTION 5

1. Certain saturated fatty acids are called ‘essential fatty acids’ (EFAs) because we cannot synthesize them, yet we need them for several key biological functions.

   True

   False

1 points   

QUESTION 6

1. Cholesterol esters are weakly amphipathic.

   True

   False

1 points   

QUESTION 7

1. For a protein to be efficiently degraded by the proteasome, it must first be polyubiquitinated.     

   True

   False

1 points   

QUESTION 8

1. Animals are dependent on plants and certain microorganisms for the synthesis of nitrogen-containing organic compounds.

   True

   False

1 points   

QUESTION 9

1. Endogenous TAGs and fatty acids are carried to the liver by chylomicron remnants.

   True

   False

1 points   

QUESTION 10

1. The surface lipids and proteins of lipoprotein particles have many covalent bonds between them that stabilize the particles during transport through the bloodstream.

   True

   False

1) How many ATP molecules are consumed in the hexose stage of glycolysis for every one molecule of glucose?

A) 0; ATP is produced, not consumed, by glycolysis.

B) 1

C) 2

D) 3

E) 4

2) During glycolysis, isomerization occurs during which of the following reactions?

A) Fructose 1,6-bisphosphate → dihydroxyacetone phosphate and glyceraldehyde 3-phosphate.

B) Fructose 6-phosphate → fructose 1,6-bisphosphate.

C) Glucose 6- phosphate → fructose 6- phosphate.

D) Glucose → glucose 6- phosphate.

3) An intramolecular phosphoryl-group transfer occurs when

A) 2-phosphoglycerate is converted to phosphoenolpyruvate.

B) 1,3-bisphosphoglycerate is converted to 3-phosphoglycerate.

C) Both A and B.

D) None of the above.

5) Glucose 6-phosphate allosterically inhibits

A) hexokinase I.

B) glucokinase.

C) hexokinase II.

D) All of the above

E) A and C only

6) Glyceraldehyde 3-phosphate dehydrogenase causes

A) the reduction and phosphorylation of glyceraldehyde 3-phosphate to produce 1,3-bisphosphoglycerate.

B) the oxidation of a molecule of NAD+ to NADH.

C) Neither A nor B.

D) Both A and B.

7) A cell that has been fed glucose containing carbon — radioactive with carbon 14 in carbon #1 will have ________ percent of the radioactivity in each mole of glyceraldehyde-3-phosphate.

A) 0%

B) 25%

C) 50%

D) 100%

8) Which of the following enzymatic reactions are control points for glycolysis?

A) Glucose 6-phosphate isomerase.

B) Aldolase.

C) Both A and B.

D) Neither A nor B.

9) Mutases are described as

A) polymerases that catalyze phosphoryl group transfers.

B) isomerases that catalyze the transfer of phosphoryl groups from one part of a substrate molecule to another.

C) forming intermediate free phosphate (Pi).

D) All of the above.

10) Which of the following mutases catalyze the formation of a 2,3-BPG intermediate?

A) Muscle phosphoglycerate mutases.

B) Plant phosphoglycerate mutases.

C) Yeast phosphoglycerate mutases.

D) A and C only.

E) All of the above.

11) Transfer of the phosphoryl group from PEP to ADP is an example of

A) a mutase reaction.

B) isomerization.

C) dehydrogenase.

D) substrate-level phosphorylation.

12) Enzymes that catalyze the same reaction are called ________.

A) isozymes

B) complementary enzymes

C) cofactors

D) catalytes

13) Compared to pyruvate, the carbon atoms in lactate ________.

A) are more reduced

B) are more oxidized

C) are equally as oxidized

D) carry more charge

14) Under what situation might lactic acidosis occur?

A) Lactate dehydrogenase is inactive.

B) Transport of glucose into cells is accelerated.

C) Oxygen supply to tissues is inadequate.

D) PFK-1 is over-activated.

15) Seven of the ten reactions in the glycolytic pathway have free energy values close to zero. What does this tell us about those reactions?

A) They are near equilibrium reactions.

B) They are not control points for pathway regulation.

C) They are reversible reactions.

D) All of the above.

E) None of the above.

16) Some reaction steps in the glycolytic pathway have positive standard free energy changes. Which statements apply?

A) The standard free energy for these steps is not the same as the actual free energy change in cells. The actual free energy change must be negative or zero.

B) The reaction steps with positive standard free energy changes are likely to be regulatory steps for the pathway.

C) The steps with a positive standard free energy change are the fastest steps in the pathway.

D) The steps with a positive standard free energy change must be coupled to an ATP →ADP conversion.

17) Once inside a cell, glucose is rapidly phosphorylated to glucose-6-phosphate. What is the main purpose of this phosphorylation?

A) To keep glucose inside the cell.

B) To form a high-energy compound.

C) To activate PFK-1.

D) To prevent mutarotation.

18) More than one step in the glycolytic pathway is subject to regulation. It might seem most efficient to regulate only the first step of a pathway to avoid buildup of intermediates and to conserve materials and energy. Why is the first step of glycolysis not the only regulated step?

A) Some sugars can enter the glycolytic pathway beyond the first step. If steps other than step one were not regulated, the breakdown of these sugars would be essentially uncontrolled.

B) Having more than one regulated step in the pathway allows for feedback inhibition.

C) Control of a single step in a reaction pathway is difficult because the concentrations of enzymes in cells are very low. It's easier to control more than one enzyme.

D) All the ATP in a cell would be depleted very quickly if only the first step of glycolysis were regulated.

19) PFK-2 and fructose 2,6-bisphosphatase are two names for the same enzyme. The name PFK-2 is used for the enzyme's catalysis of the phosphorylation of fructose 6-phosphate to fructose 2,6-bisphosphate. The name fructose 2,6-bisphosphatase is used for its catalysis of the reverse reaction. What is unique about this enzyme that makes it logical to use two names?

A) It is one of very few enzymes that can catalyze both the forward and reverse reactions.

B) The enzyme is a monomer when catalyzing the phosphorylation reaction and a dimer when catalyzing the reverse reaction.

C) The forward and reverse reactions occur in different compartments within the cell, so a different name is used for each activity.

D) The enzyme is bifunctional. The forward and reverse reactions are catalyzed by different sites on the same enzyme.

20) In the liver, ________ has a main use for maintaining blood glucose, but it can also be used to synthesize glycogen, or enter the pentose phosphate pathway to produce ribose 5-phosphate.

A) glucose-1-phosphate

B) glucose-1,6-bisphosphate

C) fructose-6-phosphate

D) glucose-6-phosphate

21) How does mannose enter the glycolytic pathway?

A) It is converted mannose 6-phosphate and then isomerized to fructose 6-phosphate which enters the pathway.

B) It can enter directly into the first step of glycolysis because hexokinase converts mannose to glucose 6-phosphate.

C) Mannose is first split into two trioses that are directly converted to glyceraldehyde 3-phosphate.

D) Mannose is not metabolized via glycolysis. It enters a separate pathway.