1) Given your understanding of transcription and translation, fill in the items below with the proper sequences. Please align your answers under the nontemplate DNA strand. Ignore RNA stop codons if they are present.

Nontemplate strand of DNA:                 5′- A T G T A T G C C A A T G C A -3′

     Template strand of DNA:       

                                 RNA:       

             Anticodons on tRNA:      

            Amino acid sequence:

2) Original template strand of DNA:  3′- T A C G C A A G C A A T A C C G A C G A A -5′

a. Transcribe this sequence:

                                      RNA:

b. Translate the RNA sequence. Ignore start/stop codons if present.

                 Amino acid sequence:

3) The table below lists five single-base point mutations that may occur in DNA. What happens to the amino acid sequence as a result of each mutation? (Position 1 refers to the first base at the 3′ end of the DNA strand. Position 21 would refer to the last base at the 5’ end.). Note that amino acids are numbered from L à R as 1-7.

Original template strand:  3’ TACGCAAGCAATACCGACGAA 5’

                   RNA strand:

     Amino acid sequence:                                                            (number aa’s 1-7 L-R)

4. Under each of the following conditions, please predict the effect the mutation will have on the rate at which glycolysis will proceed in liver cells:

a. Loss of the allosteric site for ATP in phosphofructokinase

b. Loss of binding site for citrate in phosphofructokinase

c. Loss of the phosphatase domain of the bifunctional enzyme that controls the level of fructose 2,6-bisphosphate

d. Loss of the binding site for fructose 1,6-bisphosphate in pyruvate kinase.

The molar absorption coefficients of tryptophan and tyrosine at 240 nm are 2.00 x 103 dm3mol-1cm-1 and 1.12 x 104 dm3mol-1cm-1 , respectively, and at 280 nm they are 5.40 x 103 dm3mol-1cm-1 and 1.50 x 103 dm3mol-1cm-1 . The absorbance of a sample obtained by hydrolysis in a 1 cm cell was 0.660 at 240 nm and 0.221 at 280 nm. What are the concentration of the two amino acids?

Without calculating, which amino acid is more abundant?

Calculate the concentrations

The coding region alone for the important BRCA1 tumor supressor gene in humans contains 5,592 bp (base pairs) of DNA in the coding region. Mutations in the BRCA1 gene associate with breast and ovarian cancer in humans and "carriers" of BRCA1 mutations have a ~50-65% chance of developing breast cancer by age 70.

with the above info alone calculate (i) the predicted number of amino acids for the encoded BRCA1 protein, and (ii) predict the molecular weight of the BRCA1 protein in kDa, using the average amino acid molecular weight.

1. Fill in the blanks in the table below:

2. Highlight the correct answer for each pair: Which is bigger, a monomer or a polymer? an amino acid or a protein? a monosaccharide or a polysaccharide? a nucleotide or DNA?
3. Fill in the blanks: Condensation reactions ______________ (make or break?) polymers by __________ (adding or removing?) water.
4. Name an example of a polysaccharide. What is the name of the monomer that comprises this polysaccharide?
5. What is the function of the polysaccharide you named in #4? Where is it found (animals or plants)?

Explain the Bohr effect. How does pH (and pKa) and CO2 affect the binding affinity of oxygen to hemoglobin in the lungs and in tissues? Which of the specific amino acids in the hemoglobin molecule are involved in facilitating the interactions that affect oxygen binding affinity. How is CO2 transported from the tissues to the lungs?

construct a c++ program that calculate/print the molecular weight of the below five amino acids

Oxygen: 15.9994

Carbon: 12.011

Nitrogen: 14.00674

Sulfur: 32.066

Hydrogen: 1.00794

The program should prompt the user to enter the number of each one of the atoms and then print/compute the molecular weight.

Nucleotides of DNA are joined by a ____________ to form polynucleotides whereas amino acids are joined by a ______________ to form polypeptides.

Group of answer choices

Phosphodiester linkage / hydrogen bond

Phosphodiester linkage / glycosidic bond

Peptide bond/ phosphodiester linkage

Hydrogen bond/ peptide bond

Phosphodiester linkage/ peptide bond

Match each functional group to the best description of its physical and chemical properties.

Carboxyl group, phosphate group, hydroxyl group, methyl group, or amino group.

Nonpolar, hydrophobic, found in hydrocarbon chains.

Polar, soluble, forms H bonds, forms alcohols.

Polar, soluble, protons can dissociate from this group and it has acidic properties.

Polar, soluble, can act as a weak base and accept a proton, found in proteins and nucleic acids.

Polar, soluble, found in nucleic acids, can be acidic if it loses protons.