Questions
Natasha was certain she was looking younger despite her 58 years on this Earth. Every day...

Natasha was certain she was looking younger despite her 58 years on this Earth. Every day in the mirror her lines seemed to disappear. She had searched so long for something to slow the process of aging; her marriage depended on it! Vladimir would never stay with her if he saw the wrinkles she did! Even her precious parrot, Bruno, had noticed and shied away from her! She could never live without him so she tried it all: mercury creams, Botox, weight pills from the ancient woman in the south side market of Moscow, Switzerland’s best cell therapy, and one pint of honey and another of yogurt every day!

But a week or two after her “youth” came back she wasn’t feeling nearly so good…. Finally she went to the hospital because her fever was so high (102.8). She also had a non-stop horrible cough, muscle aches, vomiting, diarrhea, and a terrible headache. As the attendant physician at the hospital you try to narrow it down based on the patient profile, potential exposures and symptoms.

What are the top five suspects for Natasha’s infectious disease? Justify your choices. (10 points)

You send off for some laboratory tests right away and find the information below. Explain these results. Does this change your diagnosis? If so how? (6 points)

Leukocytes – 6,000,000,000/L

Platelets – 700,000/ L

RBC – 450,000,000/L

Hb – 14g/dL

HCT% - 49

Bilirubin – 6 mg/dL

Creatinine – 0.97 mg/dL

Natasha’s cough got worse and worse and the clock seemed to be ticking. The results of the molecular and immunological panel are below. Has your reasoning been confirmed? Interpret them and describe how they work. (12 points)

Western immunoblotting (first lane ladder, second Natasha’s blood, third positive control, fourth negative control)

LPS - 240 KDa

83149 antigen - 208 KDa

FlaA - 99 KDa

rRT-PCR

What is this organism doing in Natasha’s body to cause disease? (pathogenesis, virulence factors, detail) (15 points)

How did Natasha’s innate immune system try to protect her from the infection? (make sure it is specific for this type of attack) (10 points)

Please describe the acquired immune reaction that occurred in response to this infection. (make sure it is specific for this type of attack) (20 points)

What treatment would you prescribe after confirming your original diagnosis? How does each part of that treatment work? (6 points)

You sent off a sample for sequencing in order to aid in prescribing the proper treatment and got the following sequence back:

TGGATTATGCGATGTCGGTCATTTTGGACCGGGCTTTGCGCATATCGCAGACGGTTTAAAGCCCGTCCAGCGTCGAATCGTGTACGCCATGTCAGAATTGGGTTTAAAATCAACCGCTAAGTATAAGAAATCAGCGCGGACGGTAGGCGACGTTTTGGGTAAATTCCATCCGCACGGAGACACCGCCTGTTACGAGGCCATGGTATTGATGGCCCAACCTTTTTCATTTCGCTATCCCTTTGTCGATGGGCAAGGCAATTGGGGGAGCGCGGATGATCCC AAATCCTTTGCCGCCATGCGTTATACGGAAGCACGTCTG

Describe the complete process, step by step, that this protein plays a role in. (6 points)

Use an online tool to transcribe and translate the sequence and paste below. Describe how that would be done inside the cell of the pathogen in detail. (10 points)

E.coli has a glutamine at position 87 in this protein. Our pathogen has a glycine. Speculate on how this affects the organism and it’s ability to cause/maintain/spread disease in humans. Give molecular detail. (5 points)

In: Biology

This writing assignment will involve implementing and analyzing a behavior modification program on yourself. The behavior...

This writing assignment will involve implementing and analyzing a behavior modification program on yourself. The behavior is ANXIETY OF MEETING NEW PEOPLE. This assignment is to develop your own functional behavior assessment. A minimum of 3 paragraphs per question is required.

Modification Plan: In this section, you need to describe your assessment and intervention plan. How will you collect data on the behavior in order to evaluate whether or not it is changing? Describe any forms or graphs you plan to use. What behavior modification technique or techniques will you use? If you had someone else involved (for example, giving rewards) who else was involved and what did that person do. You may feel free to create your own rating and self-monitoring forms. Be creative but please note that the plan is to effectively "modify" the target behavior. You are more than welcome to reference the scientific literature (including our textbook) to get behavior modification ideas (three paragraphs or so).

The Data: Your program should consist of two phases. First, collect some baseline data for at least a week. What is the frequency or intensity of the behavior before you started your behavior modification program? Second, collect some treatment data for at least a week. The data does not have to be "real." In other words, please draw a a hypothetical line graph that shows both baseline and treatment phases how the data would "look like." You are also more than welcome to use tables to present how your behavior changed from baseline to treatment. Please do NOT just attach graphs. You need to analyze and summarize the data in this plan (a graph, table, and detailed explanation.

In: Psychology

How did Reagan’s policies reinforce the views and stereotypes that many white American had about social...

How did Reagan’s policies reinforce the views and stereotypes that many white American had about social programs and the welfare state? What did the Reagan administration do to promote those stereotypes and beliefs? What stopped Democrats from being able to refute these stereotypes? What beliefs and stereotypes from this era still exist today?

In: Economics

We are evaluating a project that costs $896,000, has eight year life, and has no salvage...

We are evaluating a project that costs $896,000, has eight year life, and has no salvage value. Assume that depreciation is straight-line to zero over the life of the project. Sales are projected at 100,000 units per year. Price per unit is $38, variable cost per unit is $25, and fixed costs are $900,000 per year. The tax rate is 35%, and we require a 15% return on this project.

no excel, please :)

a- Calculate the accounting break-even point. What is the degree of operating leverage at the accounting break-even point? (77,847 units; 9.04)

b- Calculate the base-case cash flow and NPV. What is the sensitivity of NPV to changes in the sales figure? Explain what your answer tells you about a 500-unit decrease in projected sales.(Base case: $299,200; $446,606.60; After 500 unit decline: $294.975; $427,647.66)

c- What is the sensitivity of OCF to changes in the variable cost figure? Explain what your answer tells you about a $1 decrease in estimated variable costs. ($364,200; $65,000)

In: Finance

Use medication Active Learning Template describing in detail of Levothyroxine. Complete only the following sections: ...

Use medication Active Learning Template describing in detail of Levothyroxine. Complete only the following sections:

 Medication- Medication Type  Category Class- Drug class  Expected Pharmacological Action  Therapeutic Uses  Complications  Medication Administration  Contraindications  Nursing Interventions  Interactions  Evaluation of Medication Effectiveness  Client Education b. Select a disease process that the selected

In: Nursing

Show all of your work. Assets                                      &nb

Show all of your work.

Assets                                                             Liabilities and Owner’s Equity                  

A/P

$60,000

LT Debt

100,000

Total Debt

160,000

CS, par

2,000

PIC

50,000

R/E

50,000

Total Equity

$102,000

Total Liabilities and Owners Equity

$262,000

Cash

$1,000

A/R

6,500

Inventory

62,500

Prepaids

12,000

Fixed Assets

250,000

Accum Depreciation

(70,000)

Total Assets

$262,000

Sales

$800,000

COGS

370.000

Gross Profit

430,000

Operating Exp.

-170,000

Depreciation

-10,000

EBIT

250,000

Interest

-10,000

EBT

240,000

Taxes

-80,000

Net Income

$160,000

Prepare a financial analysis of this company (using ratios and your rationale) and comment on its status and performance in the space below. Use another page if you need more room. Explain what the ratios depict about the financial status of the company.

In: Accounting

As our module reading highlights, applying test-taking skills involves what students do before, during and after...

As our module reading highlights, applying test-taking skills involves what students do before, during and after the test. It includes managing test anxiety, becoming familiar with types of test questions, and using tests as a learning tool.

Think about these components as you review your process in applying test-taking skills.

Share responses to the following questions or statements:

  • Explain how one or two of these suggestions for managing test anxiety can help you manage stress in test-taking and in a situation you face outside school.
  • In addition to better grades, describe at least one benefit you could experience by taking tests more effectively.
  • Of the techniques that you gained from this chapter, choose one that you will use on your next test. Cite it and outline exactly how you intend to apply the technique.

In: Psychology

unit 6 DB food The purchasing function is responsible for identifying the operational needs of the...

unit 6 DB food

The purchasing function is responsible for identifying the operational needs of the organization, negotiating, determining product specifications, and working with and choosing vendors. Managers are charged with making the appropriate buying decisions in an ethical and professional manner.

Topic: Purchasing and Technology

You read about blockchain ledger technology. Now do some additional research out on the Internet and share your URL with the rest of the class regarding either videos or viable information regarding blockchain technology.

Make sure to title each response as Part A or Part B.

Part A: Technology

  • Discuss how you think this technology will change food and beverage purchasing. Explain your response.
  • Discuss how POS systems are used in eating establishments. When does it make sense to use a POS system? What advantages are there for management in using a POS system?

In: Operations Management

Concentration of NaOH solution= 0.02803 M Concentration of Crystal Violet dye solution=0.001 M Room Temperature =25...

Concentration of NaOH solution= 0.02803 M

Concentration of Crystal Violet dye solution=0.001 M

Room Temperature =25 degree celcius

Absorbance from the device- spectrovis(spectrophotometer)

The data in the trials are the absorbance.

-Its not Organic chemistry. Its an experiment about the crystal violet dye. Mainly they want to know how we get the rate law using these numbers.  It's asking for the rate law through these 2 trails and its asking to use some numbers to show how its solved . I also provided the procedure of the experiment.

1. Make sure the SpectroVis is plugged in to the LabQuest and the Labquest is plugged into a power outlet. 2. Turn on the Vernier by pressing the power button on the top 3. If it ask to Auto Recover, press no. 4. Tap Mode at the top right 5. Change the mode from Full Spectrum to Time Based. 6. Change the Interval to 30 seconds per sample 7. Make the Duration 450 seconds. 8. Tap OK 9. Tap Red USB: Abs 10. Tap Change Wavelength to 540 nm 11. Press Play in the bottom left, and allow Warm up for 90 seconds 12. Place Blank cuvette (NaOH) in SpectroVis. Ensure clear side is facing the arrow 13. Tap Finish Calibration 14. Add Crystal violet dye and immediately replace cuvette in SpectroVis and press ok. 15. Allow running for 450 seconds. 16. Press the file cabinet to ready a second trial 17. Repeat steps 11 and 12. 18. Get a fresh aliquot of NaOH of the second concentration. 19. Do two more trials with a second concentration of NaOH.

Time

Time: Trial 1 Trial 2

0 0.335 0.435

90 0.279 0.363

120 0.188 0.248

150 0.158 0.206

180 0.095 0.135

210 0.075 0.106

240 0.055 0.083

270 0.037 0.063

300 0.023 0.046

330 0.013 0.030

360 0.000 0.018

390 -0.007 0.006

420 -0.014 -0.002

450 -0.020 -0.009

The following calculations must be handwritten in your notebook. – Conversion of %Transmittance to Absorbance ■ Only one handwritten sample is necessary ■ However, all of your %Transmittance values must be converted to Absorbance in your Data Table

–The steps you took to determine the order with respect to the Crystal Violet Dye (X in the example)

– The steps you took to determine the order with respect to the NaOH (Y in the example)

– The steps you took to determine k – The overall, Modified Rate Law ■ With your values for X, Y, and k inserted into the equation

– Solve the Rate Law ■ Insert in all values necessary Result

Answer in steps please and in detail in order for me to understand it. I will appreciate your help thank you.

In: Chemistry

Use supply and demand to explain and show the following real-world situations graphically and in a...

Use supply and demand to explain and show the following real-world situations graphically and in a short paragraph. Be sure to explain what happens to the market quantity and price with a supply and demand diagram as precisely as possible.

a) The cost of producing sport utility vehicles (SUVs) decreases because tariffs are reduced on the steel and aluminum used to produce these vehicles. Explain what happens to the market quantity and price of SUVs.

b) The fungus Fusarium destroys 30% of worldwide banana production. Explain what happens to the market quantity and price of bananas.  

c) On Valentine’s Day, the price of roses increased by more than the price of greeting cards. The price of greeting cards didn’t even appear to change. Why? You will want to use graphs of both the market for roses and the market for greeting cards to explain your answer.

In: Economics