The police chief wants to know whether the city’s non-whites feel that the police are doing a good job. In comparison to whites’ evaluation, this information will tell the police whether they have a community relations problem in the non-white community. A survey reveals the data in the accompanying table.

a) What can you tell the police chief about the contingency table? Do the city’s non-whites feel the police are doing a good job?

b) Explain the various steps you must perform when conducting a Chi-square analysis?

c) Perform a chi-square analysis to test the relationship between race and attitude toward the police. Discuss and provide a substantive interpretation of your findings.

1.) Using the information contain in Table 1, calculate the following:

a. Each group’s proportion of the total sample

b. Turnout by group

c. The proportion of votersin each group that supported Hillary Clinton

d. The proportion of votersin each group that supported Donald Trump

Table 1: Voting Behavior by Group in 2016 (Source: 2016 American National Election Survey)

Summer Tyme plc is considering a new three-year expansion project that requires an initial non-current asset investment of £3.9 million. The non-current asset actually is depreciated straight line to zero over the three years of the project. The project is estimated to generate £2,650,000 in annual sales, with costs of £835,000.Suppose the required return on the project is 13 per cent, the project requires an initial investment in net working capital of £300,000, the tax rate is 27 per cent and the non-current asset actually is depreciated straight-line to zero over the three years of the project. What is the project’s year 1 net cash flow? What is the project’s year 2 net cash flow? What is the project’s year 3 net cash flow? What is the project`s NPV?

( Should we consider net working capital in net cash flow year 3?

When managing the performance of an organization, the leadership is always balancing between the risks and rewards of using financial and non-financial information as well as internally and externally sourced information, in its performance report.

(a) Define and provide an example of each of the following:

            i. financial information and non-financial information.                 

            ii. internally and externally sourced information.

Word count should be a minimum 150 words, not exceeding 250 words.

(b) Elaborate on the benefits and issues of using the following information:

i. financial information versus non-financial information. (6.5 marks)

ii. internally sourced information versus externally sourced information.             (6.5 marks)

For each set of information, there should be at least two advantages and two disadvantages provided (no tables allowed, your answers should have proper headers and paragraphs and word count should be a minimum 350 words, not exceeding 450 words.            Marks will be awarded for format.                                               

On January 1, 2017, Bramble Company issued $ 1,820,000 face value,  7%,  10-year bonds at $ 1,953,954. This price resulted in a  6% effective-interest rate on the bonds. Bramble uses the effective-interest method to amortize bond premium or discount. The bonds pay annual interest on each January 1.

Prepare the journal entries to record the following transactions. (Round answers to 0 decimal places, e.g. 125. Credit account titles are automatically indented when amount is entered. Do not indent manually.)

eTextbook and Media

List of Accounts

Show the proper long-term liabilities balance sheet presentation for the liability for bonds payable at December 31, 2018. (Round answers to 0 decimal places, e.g. 125.)

eTextbook and Media

List of Accounts

Provide the answers to the following questions.

1. What amount of interest expense is reported for 2018? (Round answer to 0 decimal places, e.g. 125.)

2. The bond interest expense reported in 2018 would be  select an optionselect an option  greater thanless thansame as the amount that would be reported if the straight-line method of amortization were used.

1. The lab tested for certain expressed virulence factors from Chris ’s actual serum and found:

>cDNA  

TTGCTCTTACTTCCGGTTCGCAGCGTACAGTTAAGAAGAGCAAGCACGATACGCCGCCAAGGTGGCCTCA GTCGACTAGCAATGCAGCTCGTGCCGCGAGAGATCGATAAACTGACCATCTCTAATCTGGGATTTCTGGC CCAGCGGAGATTGGCCCGGGGAGTGAGGTTGAATCATGCAGAAGCGACTGCGTTGATCGCATCCAATCTC CAAGAGCTTATTCGAGATGGCAACAATTCGGTGGCAGATCTCATGACGATCGGCAAGGAGATGCTTGGAC GTCGACATGTCCTACCCTCTGTCGTGGCCACCTTGAAACAAGTTCAAGTTGAAGGAACTTTTCCCACTGG GACGAACCTGATCACCGTGGTCAATCCCGTTTGTTCGGATGATGGCGACCTGGAGAAAGCCCTCTACGGA AGCTTTTTGCCTGTGCCGCCGAAAGAAACGTTCCCGGATCCTGATCCGGATGACTATCAGCCAGAGAAGA TGCCTGGCGCTGTGATACCCCTCAAAACGAGCAAGAAAATTGAGCTCAATGCCGGGAGAAATAGAATTAT GCTTAAAGTGACAAGTCGAGGAGACCGGCCCATTCAGGTTGGTTCACACTATCATTTTATAGAGGTGAAT CCACAATTGGACTTCGACCGTGCGAAGGCGTACGGATATCGCCTTGACATCCCAGCTGGGACGTCTATCC GCTTTGAACCCGGTGCTACCAAGGCAATCCCGCTCGTCGAAATTGGCGGCAAGAGAATCATTCGAGGGGG CAACCACATCGCCGTTGGGCAGGTGGATTTCCGAAGAGTTGATGAAATCATCATGCGTCTGCAAAAAGCT GGATTTGCGTATACTCCGGAGCCTAAACAGGATGCTCATTTGATCGAGCCATTTTCAATGACGCGGGAAG CATATGCTCGCATGTTTGGTCCTACCACTGGAGATGTAGTCAAGCTAGGAACCACAGATTTGTGGATTAA AGTCGAAAAGGACCTGACCTACTACGGTGACGAATGTTCATTCGGTGGTGGCAAGACCATAAGAGACGGG ATGGGGCAAGCTACAGGAAGGCATTCCGTGGATGTCCTGGATACAGTCCTGGTGAACGCGCTAATTGTCG ATTGGACGGGTATTTACAAGGCTGATATTGGACTAAAAGATGGAATGATCTGCGGAATCGGCAAAGCTGG AAACCCAGACGTGATGGATGGTGTCACCCCCAATATGATAGTTGGCTCTTCGACAGATGTTATCGCATGT GAAGGAAAAATTGTCACTGCAGGAGGAATTGACACACACGTCCATTTTATATGCCCACAGCAGGTCGAGG AAGCCCTCGCCTCCGGAGTCACGACTCTTCTCGGTGGCGGCACCGGTCCAACTGAGGGAACAAATGCGAC TACATGCACACCGGCTCCAAATCAATTCAAGACGATGATGCAGGCTTGTGATCATCTTCCAATAAACGTT GGCCTTACAGGCAAAGGTAATGACAGCGGTCTTCCATCTCTGAGGGATCAATGCCGTGCAGGAGCCGCCG GCTTGAAGGTGCATGAAGATTGGGGTGCAACGCCGGCTGTCATTGATACATGCCTCCAGGTCTGCGACGA GTTCGATATTCAATGTCTCATCCATACCGACACCCTGAACGAATCTGGCTTCGTTGAACAGACCGTCAAT GCCTTTAAAAATCGAGTGATTCATACGTACCACACTGAGGGTGCTGGAGGAGGCCACGCTCCAGATATCA TATCCGTCGTCGAGAAGCCAAACGTCCTGCCCAGCAGTACGAATCCCACTCGTCCGTATACGGTAAATAC TTTAGATGAACATCTGGACATGGTAATGGTCTGCCATCATTTGTCCAAAGATATTCCTGAAGACGTGGCT TTTGCGGAAAGCCGGATCCGATCCGAGACAATTGCTGCAGAAGACGTTCTTCATGACACGGGAGCCATCA GCATGCTATCCTCGGACTCTCAAGCTATGGGACGCTGTGGAGAAGTTGTTGTCCGGACATGGAACACTGC ACATAAGAATAAAATGGAACGAGGGCGACTCAAGGAGGATGAAGGGACGGATTCTGATAATTTTAGGGTT AAACGGTATATCAGCAAGTACACCATCAACCCTGCCATTGCACAGGGGATGGCCTACACTATTGGGAGCG TGGAAGTTGGCAAGACCGCTGATTTGGTTCTGTGGAAATTCGCCAACTTTGGGACTAAACCGAGTATGGT CTTGAAGTCTGGAATGGCTGTCTCAGCGCAGATGGGTGATCCCAATGGCTCTATCCCCACAATCGAGCCT ATTATTATGAGGCCTATGTACGCTAGTCTTAACCCTAAAGCCTCAATCATGTTCGTATCCCAAGCATCCA TCAAGCTTGGTATCATCGACAGTTACCACCTGAAGAAGCGGATCGAGCCAGTGAAGAATTGTCGGAATAT AAGCAAGAGAGATATGAAATTTAATGATATTATGCCCAAAATGAGAGTCGATCCGGAGAGCTATGTTGTC GAGGCTGACGGGGAAGAGTGTACCGCTGAGCCAGTGTCAGAGTTGCCTTTAACACAAGACTATTTCGTTT ACTGAAAATTGGTGGAGACCATAGAACGTCTCCACAGATTAGTCGTGGAAAAGTAATGCTCATGGCGATA GTATCCTTCTGTACCTCTTTTGATGAATATTAGTACATTTTATTGCATATCTATTCCTTTGGTCCTGTGC GTCTCCACGTGAGCATCCCTTTTTGCTAATCCCCAACGCCCTACAGAGATGGACCATTGACTTATCTGAA ATTCTAAATTCGCAATAAGCTCTCCCAGAAAAACAGTAAGATCACGCGCCCGGAACTCCTTGCTCCCAAA AAAAAAAAGGAATACAACTATTTAAAGCTCTTCATCCATCACAGTATGGTTATTGCCTGCCGAAATGAGC GAGTAGAGAGTCGACCACGTCTCGTGCTTGGCCGCACGATACGCAGAGATCCTTGAATGCATACGTCTTA GCATGGACGCCTTGCGGTCCTGACAACTAGGTGGGAGGGTTGTGGCTTGGGCCGGAT 

1. Paste this sequence into blastx. What is the top result and how does it affect the host (brief)?
2. This tool automatically translates a sequence and checks for the protein in the database. Describe how that would be done biologically inside the infectious agent in detail

1. Why is application integration an important part of running an online business?

2. Why would database management software be an important component of an online business Web site’s technology?

3. What is the key function of a content management system as used in an online business?

4. Name four types of information that might be useful inputs to a customer relationship management (CRM) system.

5.Briefly explain why mobile advertising is growing so rapidly.

6.Explain what online text ads are and briefly describe their advantages over online display ads.

7.What is an ad exchange network and how does it differ from a display advertising network?

8. Briefly define and distinguish between emotional and rational branding.

2. Draw an entity relationship diagram (ERD) for the following situation:

The state of Georgia is interested in designing a database that will track its researchers. Information of interest includes researcher name, title, position; university name, location, enrollment; and research interests. Each researcher is associated with only one institution, and each researcher has several research interests.

3. Visit a Web site that allows customers to order a product over the Web (e.g., Amazon.com). Create a data model that the site needs to support its business process. Include entities to show what types of information the site needs. Include attributes to represent the type of information the site uses and creates. Finally, draw relationships, making assumptions about how the entities are related.

In this problem, you will research reporting entities for governments in the GASB’s Governmental Accounting Research System (GRS). Access the GRS database citing your results from the GASB guidance with utmost authoritative guidance. Provide requisite examples as requested from the GRS and cite your results from the Codification. Minimum of 2 pages required. Research the accounting issue and formulize your findings in a formal research memo. The formal memo should be in good form with proper grammar, conveying the results of your research.

Define a financial reporting entity. Give an example of a primary government. Define and give an example of a component unit. Explain the two methods of reporting the primary government and component units in the financial reporting entity and when each is required.