The following data set is obtained by a randomly selected sample of 93 employees working at a bank.

This data set was obtained by collecting information on a randomly selected sample of 93 employees working at a bank.

SALARY-  starting annual salary at the time of hire

EDUC  -  number of years of schooling at the time of the hire

EXPER -  number of months of previous work experience at the time of hire

TIME   -  number of months that the employee has been working at the bank until now

2. Use the least squares method to fit a simple linear model that relates the salary (dependent variable) toeducation (independent variable).

a)  What is your model? State the hypothesis that is to be tested, the decision rule, the test statistic, and your decision, usinga level of significance of 5%.

b)  What percentage of the variation in salary has been explained by the regression?

c) Provide a 95% confidence interval estimate for the true slope value.

d) Based on your model, what is the expected salary of a new hire with 12 years of education

e ) What is the 95% prediction interval for the salary of a new hire with 12 years of education? Use the fact that the distance value = 0.011286

Please explain clearly.

1. Some carbohydrates are used for energy storage, while some are used to maintain rigid cell structure.

1. Give one example of an energy storage carbohydrate found in plants.

1. What type of monomers makes up this carbohydrate?

2. Give one example of a structural carbohydrate:

1. What type of monomers makes up this carbohydrate?

2. What type of organism (plant or animal) would make this carbohydrate?

3. Where would you find it within a cell?

2. In class we described Nucleic Acids, Proteins, and Carbohydrates as being monomers and polymers. Fill in the chart below. Only use one term per box.

3. Match the cell component with the type of biological macromolecule (Proteins, Carbohydrates, Nucleic Acids, or Lipids)

1. Plasma membranes are made mostly of
2. The cytoskeleton is made of                                              
3. Cell walls are made mostly of                            
4. Channels in the plasma membrane that help with transport of materials in and out of cells are made of …                                  

4. What is the structural difference between a saturated and unsaturated fat? How does that difference affect the property of the fat? (Answer in 1-2 sentences)

5. All enzymes are _____________________________ (name a specific type of macromolecule).

6. Are carbohydrates hydrophilic or hydrophobic? Look at the types of covalent bonds in between atoms of a carbohydrate (are some polar? non-polar?). Explain why those bonds support your answer. (answer in 1-2 sentences)

Burrell Company purchased a machine for $49000 on January 2, 2016. The machine has an estimated service life of 5 years and a zero estimated residual value. The asset earns income before depreciation and income taxes of $24500 each year. The tax rate is 25%.

Required:

Compute the rate of return earned (on the average net asset value) by the company each year of the asset's life under the straight-line and the double-declining-balance depreciation methods. Assume that the machine is the company's only asset.

Straight-line method. Do not round intermediate calculations. Round final answer to two decimal places.

2016?

2017?

2018?

2019?

2020?

Double-declining-balance depreciation method. Do not round intermediate calculations. Round final answer to two decimal places.

2016?

2017?

2018?

2019?

2020?

1) what chemically breaks proteins down into large polypeptides?

pepsinogen

protease

bile

pepsin

2) which of the following is involved in converting pepsinogen to pepsin?

hydrocholric acid

renin

pancreatic protease

salvary amylase

A and B

A,B and C

3) what does amylase do to maltose?

emulsifies it into sugars

mixes it with proteases

converts it into starch

hydrolyzes it into glucose

4) what is expected to happen when amylase is temperatures of 60 or above?

will decrease

be the same

will increase

will not change

5) what is the primary source for the bulk of the lipase used in the gastrointestinal tract?

liver

pancreas

stomach gallblader

6) what are building blocks of lipids?

sugars and starches

triglycerides and nucleotides

nucleotides and amino aicds

fatty acids and monoglycerides

5) Genetically modified organisms: A) have acquired genes artificially, B) cause disease and mutations in humans, C) are not important in agriculture; D) are not regulated and therefore unsafe

6) Therapeutic cloning of embryonic stem cells can: A) produce all cell types in the body; B) save human lives; C) be obtained only from embryos; D) all are true

7) Cutting DNA with a specific restriction enzyme produces _____ that can be separated by gel electrophoresis. A) restriction fragments; B) enzymes; C) recombinant DNA; D) plasmids

8) DNA fingerprinting can be used to rule out or eliminate a suspect in a crime but not to identify a perpetrator (criminal). (True/False)

9) The human genome (entire DNA of a human) contains about 25,000 genes and about 50% of that genome is noncoding (introns). (True/False)

10) Currently gene therapy can be said to be: A) far off in the future; B) not possible; C) cheap and easy; D) promising

11) The only area of research that will benefit from the human genome project is the study of human evolution. (True/False)

12) The human genome project is enhancing the understanding of evolutionary history. (True/False) 13) Approximately what percentage of human DNA is noncoding? A) 97%; B) 64%; C) 99.9%; D) 79%

44.

1. The biosynthesis of ATP from ADP and a phosphate group donated by a metabolic intermediate is called

   	A.	oxidative phosphorylation
   	B.	photophosphorylation
   	C.	anaplerotic reaction
   	D.	substrate-level phosphorylation

46.

1. The following is incorrect regarding the statement "A small amount of ATP is made in glycolysis."

   	A.	Enzymes producing ATP from ADP + Pi, coupled with ΔGo < 0 reactions, are called kinases.
   	B.	Substrate-level phosphorylation depends on a ΔpH and a voltage gradient.
   	C.	ATP is formed by phosphoglycerate kinase and pyruvate kinase through substrate-level phosphorylation.
   	D.	A total investment of 2 ATPs renders a total of 4 ATPs with a net gain of 2 ATPs.

46.

1. The classical point of view is that, during mitochondrial respiration, three ATP molecules can be generated from one molecule of NADH + H⁺ and only two from FADH₂. When factoring in the cytosolic NADH + H⁺, the maximum number of molecules of ATP per glucose generated by the electron transport system is _____.

   	A.	2
   	B.	4
   	C.	36
   	D.	38 47

47.

1. The advantage to the cell of the gradual oxidation of glucose during cellular respiration compared with its combustion to CO₂ and H₂O in a single step is:

   	A.	energy can be extracted in usable amounts.
   	B.	more free energy is released for a given amount of glucose oxidized.
   	C.	no energy is lost as heat.
   	D.	more CO2 is produced for a given amount of glucose oxidized.

48.

1. What purpose does the phosphorylation of glucose to glucose 6-phosphate by the enzyme hexokinase serve as the first step in glycolysis?

   		It helps drive the uptake of glucose from outside the cell.
   		It generates a high-energy phosphate bond.
   		It converts ATP to a more useful form.
   		It enables the glucose 6-phosphate to be recognized by phosphofructokinase, the next enzyme in the glycolytic pathway.

49.

The products of the tricarboxylic acid cycle are:

An HEXAPEPTIDE was sequenced using differing enzyme and chemical reagents. The results of these experiments, along with an explanation of how to interpret the results are provided below. Using this information, provide the 1 ̊ structure for this HEXAPEPTIDE.

Show work/answer for points B-F

Observations from Sequencing Experiments

A. The amino acid content in the peptide was: Y, R, M, K, G, D

B. Reactions with the peptide and 1-fluoro-2,4-dinitrobenzene yielded DNP-G.

C. Treatment of the peptide with chymotrypsin yielded two tripeptides.

D. Treatment of the peptide with trypsin yielded three dipeptides.

E. Treatment of the peptide with carboxypeptidase yielded methionine.

F. N-terminal sequencing of one the chymotrypsin-produced tripeptides (from part C) yielded DNP-K.

Acetylcholine binds to what type of receptor?

a. What does acetylcholinesterase do?

b. What happens if acetylcholinesterase is inhibited (blocked)?

c. Will ACh increase or decrease in the synapse? Increase because once the enzyme is eliminated, Ach will increase in production resulting in more responses

What type of receptors do the following bind to?

a. Epinephrine and norepinephrine

b. Dopamine

c. Serotonin

d. Histamine

i. How does a monoamine oxidase inhibitor work (MAO-I)?

ii. How does a selective serotonin reuptake inhibitor (SSRI) work?

Amino acid messengers:

a. What kind of channel does GABA open? Causes an IPSP or EPSP?

b. What kind of channel does glutamate open? Causes an IPSP or EPSP?

Answer the following questions based on this codingstrand of DNA:                                    

                                    5’ GGCCATGACAGAGGAGCAAAAGTTATTGCT 3’

Drennan et al. (1996) identified several mutations in this enzyme that result in methylmalonic acidemia (MMA). One of those mutations is a C to A at base pair 1904 in the coding strand of DNA (bold and italicized in the template strand).

1. Write the unique coding strand of DNA for this patient and highlight the change you made. Write it 5’ to 3’.
2. Write the mRNA sequence for this patient and clearly highlight the change you made. Write it 5’ to 3’.
3. Write the amino acid sequence for this patient, highlight what differs from the normal (wildtype) sequence.
4. What type of mutation is this? (insertion, deletion, silent, nonsense,missense,or frameshift mutation? Explain your reasoning.

1. The classical point of view is that, during mitochondrial respiration, three ATP molecules can be generated from one molecule of NADH + H⁺ and only two from FADH₂. When factoring in the cytosolic NADH + H⁺, the maximum number of molecules of ATP per glucose generated by the electron transport system is _____.

   	A.	2
   	B.	4
   	C.	36
   	D.	38 47

47.

1. The advantage to the cell of the gradual oxidation of glucose during cellular respiration compared with its combustion to CO₂ and H₂O in a single step is:

   	A.	energy can be extracted in usable amounts.
   	B.	more free energy is released for a given amount of glucose oxidized.
   	C.	no energy is lost as heat.
   	D.	more CO2 is produced for a given amount of glucose oxidized.

48.

1. What purpose does the phosphorylation of glucose to glucose 6-phosphate by the enzyme hexokinase serve as the first step in glycolysis?

   		It helps drive the uptake of glucose from outside the cell.
   		It generates a high-energy phosphate bond.
   		It converts ATP to a more useful form.
   		It enables the glucose 6-phosphate to be recognized by phosphofructokinase, the next enzyme in the glycolytic pathway.

49.

The products of the tricarboxylic acid cycle are: