Statistics are often calculated with varying amounts of input data. Write a program that takes any number of non-negative integers as input and outputs the average and max. A negative integer ends the input and is not included in the statistics. Ex: When the input is 15 20 0 5 -1, the output is: 10 20 You can assume that at least one non-negative integer is input. Can this be written in CORAL please!!

In related to nursing, pick up any relevant clinical disorder (either genetic or non-genetic)

These are following minimum expectations:

a. Introduction

b. clinical description

c. Genes or chromosomes involved (if it is genetic disorder)

d. Prevalence, socio economic relevance (if it is non genetic)

e. Screening methods, diagostics and treatment aspects

f. Your perspective as a health care major student

g.Future directions and conclusions

Please explain, pursuant to the Report of the Harvard Medical Practice, what role age plays as a factor for adverse events. Is there any correlation between age and the primary type of adverse event (negligence)? Secondly, is there any correlation between the type of hospital involved (i.e. government, non-profit, private propriety) and adverse events involving negligence? What about teaching hospitals vs. non-teaching hospitals?

. Regarding the folded and unfolded states of a protein (2 pt): a. Do they have the same peptide bonds? b. Do they have the same non-covalent interactions? c. Which state has more water-exposed non-polar side chains? d. Which state has higher enthalpy? Why? e. Which state has higher entropy if we consider the surrounding water molecules? Why?

A medical condition affects about 20% of non-Hispanic White Americans, 60% of Hispanic Americans, and 80% of African, Asian, and Native Americans. Seventy-six percent of U.S. residents are non-Hispanic Whites, 9% of them are Hispanic, and 15% are African, Asian, or Native American. If a person is selected from this group of people, what is the probability that the person will have the medical condition? (Give an exact answer. Do not round.)

Transcribe and translate the genes shown below. Assume that transcription starts five bases past the TATAAA box and ends five baes past the Poly-A site. Label the ends of all DNA and RNA strands. TATA box is on the NON-TEMPLATE (coding) strand. Poly A site= AATAAA is also on the NON-TEMPLATE (coding) strand.

1. 3’GGGCATTGGATATTTCGCCAAAGGGGGGTATACCCCAAACCGGCACCCGCATTGCAGGAGAGAATTCGTCCGGTTATTTCGGCG5’ 5’CCCGTAACCTATAAAGCGGTTTCCCCCCATATGGGGTTTGGCCGTGGGCGTAACGTCCTCTCTTAAGCAGGCCAATAAAGCCGC3’

2. 3’AATGCAAATAAGGATGGGGAGCAGCCTAGACCCCAAACCGGCATTGTATCGTCCGGCTCGGTTTAAATATCGGC5’ 5’TTACGTTTATTCCTACCCCTCGTCGGATCTGGGGTTTGGCCGTAACATAGCAGGCCGAGCCAAATTTATAGCCG3’

Sampling is a process used in statistical analysis in which a predetermined number of observations are taken from a larger population. The methodology used to sample from a larger population depends on the type of analysis being performed but may include simple random sampling or systematic sampling. In a student survey, illustrate how the four probability (random) sampling techniques and four non-probability (non-random) sampling techniques can be used ?

Consider the ODE u" + lambda u=0 with the boundary conditions u'(0)=u'(M)=0, where M is a fixed positive constant. So u=0 is a solution for every lambda,

Determine the eigen values of the differential operators: that is

a: find all lambda such that the above ODE with boundary conditions has non trivial sol.

b. And, what are the non trivial eigenvalues you obtain for each eigenvalue

The US Financial Accounting Standards Board does not allow revaluation of non-current assets to fair value, but it does make it compulsory to account for the impairment costs associated with non-current assets as per FASB Statement No. 144 Accounting for the Impairment or Disposal of Long-Lived Assets.

Required:

What implications do you think these rules have for the relevance and representational faithfulness of US corporate financial statements??