Submission Question 3: Polymorphism

Problem

You are writing software for a company’s human resources department. As part of the requirements, it would like to have a function that calculates the salary of an individual based on the position he or she holds, years of service, and hours worked.

This program will demonstrate the following:

• How to create an abstract class,
• How to overload a method,
• How to use polymorphism to call functions on similar objects.

Solving the Problem

Step 1

The first thing that you must determine is what attributes are common to all employees and what methods they can share. Can salary be easily calculated by the same method without some additional input from the user? By using polymorphism, you can make one method that calculates salaries for different groups. First, determine the base class and what method needs to be implemented by the child classes. By making the calcSalary() method abstract, it will be a required method of the child classes.

Step 2

You can then define the child classes that inherit the shared attributes from the base Employee class but also inherit the requirement that they implement from the calcSalary() method. Each employee type will have a different set of attributes and a different method of calculating the salary, but the same method call will be used to calculate it.

Step 3

You can now create a list to hold all employee types and populate it.

Step 4

Because you used polymorphism in the classes, you can now use one loop to calculate and output the salaries of the employees.

Documentation Guidelines:

Use Python Programming. Use good programming style (e.g., indentation for readability) and document each of your program parts with the following items (the items shown between the '<' and '>' angle brackets are only placeholders. You should replace the placeholders and the comments between them with your specific information). Your cover sheet should have some of the same information, but what follows should be at the top of each program's sheet of source code. Some lines of code should have an explanation of what is to be accomplished, this will allow someone supporting your code years later to comprehend your purpose. Be brief and to the point. Start your design by writing comment lines of pseudocode. Once that is complete, begin adding executable lines. Finally run and test your program.

Deliverable(s):

Your deliverable should be a Word document with screenshots showing the source code and running results, and discuss the issues that you had for this project related to AWS and/or Python IDE and how you solved them for all of the programs listed above as well as the inputs and outputs from running them. Submit a cover sheet with the hardcopy of your work.

Write a Java program to play the game Tic-Tac-Toe. Start off with a human playing a human, so each player makes their own moves.

Follow the design below, creating the methods indicated and invoking them in the main program.

Use a char array of size 9 as the board; initialize with the characters 0 to 8 so that it starts out looking something like the board on the left.

Make sure the board lines up properly so that the entries and borders all line up properly. DO NOT print a board that looks like or is similar to the output below where columns are misaligned.

0| O|2

3|X | 5

6 | X|O

You will need a variable to keep track of whose turn it is. Use a char variable named turn and initialize to X when the game starts. After a move, if there is no winner and no draw, switch to the O and continue to take turns as the game progresses. Declare additional variables as you build your program.

1. After the variable declarations, begin a while loop which will keep the game going the user indicates to stop the game. (see a. below)
   1. When a new games starts, allow the user to terminate the program by entering an S or s (remember String has toLowerCase and toUpperCase methods). Any other entry will start a new game.
2. If you are starting a new game, invoke a method to initialize the board and turn and another method to print the board
3. Start an inner while loop that runs as long as the game isn’t over (a win or draw will terminate the game but not the program).
4. Invoke a method to allow the user to make a move
   1. If there is no empty spot, (the game is a draw), print a message and ask the user whether to start a new game or terminate the program
   2. If the value entered is invalid (not 0 to 8), print a message and allow the user to re-enter a move
   3. If the user enters a value but it’s already taken, print a message and allow the user to retry
   4. If the user enters a value and it’s available, set the spot to X or O (depending upon the value of turn) and print the board
5. After a valid move is made, invoke a method to check if the last one to make a move won the game
   • Winner - print the winner and start a new game
   • No winner - switch turn and ask for the next position

SAMPLE OUTPUT – NOTE OUTPUT BOLDED TO SHOW HANDLING OF BAD ENTRIES

Assignment Details

The human resource employee benefits and compensation programs are built upon the in-depth evaluation of each position and the determination of its value within the construct of the organization. Job analysis is a critical component in this process. Another major part is market pricing, which assumes that the pay set by the employers is an accurate reflection of a job’s worth. Both parts are important to ensuring that equity in pay and compensation exists. In the event that equity and fairness are not always met for compensation and benefits, this could lead to employee dissatisfaction and retention problems. It is therefore incumbent upon the organization to correct any inequities.

This discussion has three parts, as follows:

1. From your perspective, what type of compensation is a greater motivator for you, and why? Ensure that your discussion provides substantial detail.
2. Think about the pros and cons associated with the concept of market pricing. What have your personal experiences been in relation to fairness and equity of your own compensation where you have worked? Use your experience to provide examples of pros and cons. Use 4 examples in your response.
3. Discuss how a compensation method can be used to assist with employee retention. Consider 4 different ways in your discussion and from your personal experiences in which you were personally impacted by the examples you have provided.

Explain the following:

• How many lenses do human eyes have and what are they called? How do they work to show us objects both close and far away? (Remember that simple glass lenses only have one focal length, unlike our eyes.) What happens as we age?
• How do humans perceive color? Can our brains be fooled into thinking we see a color (let’s say yellow) when we are not actually looking at yellow light? (Hint: This relates to TV and computer screens.)

Discuss the eyes of other animals—let’s say cats, flies, and hummingbirds. What do these animals’ eyes do better than humans’? Why does the animal benefit from these different abilities? Does the animal lack visual abilities that humans have?

Biology/ anatomy of the human body

1. Briefly discuss three structural and two functional characteristics common to the stomach, urinary bladder, and vagina.

2. Why is litmus, which detects changes in pH, an appropriate reagent to use when monitoring the effects of enzymes on lipid digestion?   

3. A drop of Patient X’s blood is mixed separately with Anti-A serum; Anti-B serum; and Anti-Rh serum. No agglutination (clumping) was observed. What is Patient X’s blood type?

4. One ml. of amylase, and one ml. of the starch solution are added to a test tube and incubated in a boiling water bath for five minutes. Five drops of iodine solution are then added to the test tube producing a dark blue / black color. Explain.

What is the basic reaction by which biological monomers form polymers?

A. hydrolysis

B. dehydration

C. mechanical displacement

If the environment surrounding a cell has a lower concentration of dissolved substances than the cell, the

A. environment is isotonic to the cell

B. environment is hypertonic to the cell

C. cell will not experience a net gain or loss of water

D. environment is hypotonic to the cell.

E. cell will die

Cell theory states that

A. life is spontaneously generated

B. New cells come only from pre-existing cells

C. cells can form from non-organic material

In a neutral atom, protons are always

A. equal to the electrons

B. equal to the neutrons

C. more than the electrons

D. less than the electrons

Water is best described as which of the following?

A. an ion

B. a non-polar molecule

C. an atom

D. a polar molecule

What allows a cell to maintain it shape?

A. the cell takes up water to remain round

B. the Golgi apparatus

C. the cytoskeleton

How do eukaryotic cells form tissues?

A. they are each either positively or negatively charged and are attracted to each other

B. their cell membranes fuse

C. they connect via the extracellular matrix

The main reason that cellular respiration needs to occur step by step instead of a single, big reaction is

A. cells don't store enough oxygen

B. cells don't have many mitochondria.

C. too much energy would be released for the cell to harness

D. cells produce the enzymes needed for cellular respiration very slowly

Isotopes of the same element are different from one another in that they have a different number of

A. neutron

B. electrons

C. protons

The energy to power the Calvin cycle comes from

A. cellular respiration

B. the light reactions of photosynthesis

C. oxygen

Which of the following can be broken down into intermediate products that enter cellular respiration?

A. Proteins

B. Lipids

C. Carbohydrates

D. All of these.

Name three organelles that are unique to plant cells.

A. mitochondria, nucleus, ribosomes

B. Golgi apparatus, mitochondria, endoplasmic reticulum

C. cell wall, central vacuole, chloroplast

If a cell has a greater concentration of dissolved substances than its surrounding environment, the cell

A. is hypertonic to the environment

B. is isotonic to the environment

C. is hypotonic to the environment

D. will not experience a net gain or loss of water

E. will die

In animal cells the primary organelle that generates molecules of ATP is the

A. ribosome

B. lysosome

C. Golgi body

D. mitochondrion

The structure that easily distinguishes a plant cell from an animal cell is

A. chloroplasts

B. nucleus

C. plasma membrane

D. mitochondria

When a plant becomes dried out

A. stomata (leaf pores) close, decreasing gas exchange

B. stomata open, decreasing gas exchange

C. stomata close, increasing gas exchange

D. stomata open, increasing gas exchange

Which is the main component of cell membranes?

A. Cholesterol

B. Sucrose

C. proteins

D. Phospholipids

The molecule that absorbs sunlight for photosynthesis is

A. oxygen

B. carbon dioxide

C. glucose

D. chlorophyll

E. sunlight

A cell produces 36 ATPs per glucose, however, if you calculated the total energy in a glucose molecule, 90 ATPs should be generated. Why is this so?

A. Some of the energy is destroyed

B. Some of the energy is used to do work in the cell

C. Some energy is lost as heat

Organic molecules are best defined as chemical compounds that contain

A. carbon

B. carbon and oxygen

C. carbon and hydrogen

The first stage of cellular respiration, called ___________, takes place in the cytoplasm of the cell and needs no oxygen.

A. glycolysis

B. citric acid cycle

C. photorespiration

D. oxidation

The products of cellular respiration are

A. carbon dioxide, glucose, and water

B. glucose, water, and ATP

C. glucose, carbon dioxide, and ATP

D. oxygen, ATP, and water

E. carbon dioxide, water, and ATP

The second energy shell of an atom contains a maximum of ________ electron(s).

A. one

B. two

C. four

D. eight

Making and breaking molecules in the body require the aid of ____________ to help the reactions begin

A. heat

B. oil

C. enzymes

D. blood

The term "functional" is used in the phrase "functional group" because it describes a group of atoms

A. that react a certain way with other molecules

B. that make the entire molecule hydrophobic

C. that are organic

What is an enzyme?

A. a protein that facilitates a reaction

B. a protein that supplies water for hydrolysis reactions

C. a protein that absorbs water during dehydration reactions

The organelle that carries out photosynthesis in plants is the

A. chloroplast

B. mitochondria

C. ribosome

D. chlorophylllysosome

What kind is it when one atom takes an electron from another atom?

A. ionic

B. covalent

C. hydrogen

How do we dispose of the carbon derived from the glucose that is metabolized during respiration?

A. via our urine

B. by breathing out

C. it is broken down in lysosomes

What kind of reaction is photosynthesis?

A. exergonic

B. kinetic energy

C. endergonic

D. potential energy

E. equilibrium

The enzyme that forms a transmembrane channel in mitochondria and phosphorylates ADP

A. a carrier protein

B. acetyl CoA

C. ATP synthase

Diffusion

A. requires energy

B. utilizes proteins to move molecules across a membrane

C. moves molecules against a concentration gradient

D. cannot occur without a membrane present

E. does not require energy

The Calvin cycle

A. produces three-carbon chains from CO2

B. produces ATP

C. degrades carbon chains

What is energy?

A. the capacity to do work

B. what holds an atom's nucleus together

C. the decay of neutrons

Eukaryotes such as animal and plants cells differ from prokaryotes in that prokaryotes

A. lack protein

B. lack DNA

C. lack a nucleus

What is G3P? What is it used for?

A. it is the first product of photosynthesis; used to make all polymers

B. it is formed following use of ATP, and functions as a carrier

C. it closes leaf pores and prevents the leaf from drying out

The prokaryotic structure that would protect a cell from drying out

A. cell wall

B. nucleus

C. plasma membrane

Although water has no overall charge, how and why does it form hydrogen bonds?

A. it is slippery

B. it is polar

C. it is liquid

How do the cells in one individual recognize each other as “self” and the cells of a transplanted organ as “not self”?

A. the cells of each individual have unique transmembrane recognition proteins

B. each individual has unique DNA

C. each individual has a unique cell wall

Entropy is

A. order

B. complexity

C. disorder

D. Both order and disorder are correct

E. Both complexity and disorder are correct

Glycolysis takes place in the _____________ and the citric acid cycle and electron transport chain take place in the ___________.

A. cytoplasm; endoplasmic reticulum

B. mitochondria, chloroplast

C. cytoplasm; mitochondria

D. mitochondria; cytoplasm

If an atom has an outer shell that is full it is

A. highly reactive

B. highly likely to combine with other atoms

C. highly unlikely to combine with other atoms

Reactions that tend to go on their own, releasing energy, are called:

A. endergonic

B. exergonic

C. catalytic

D. productive

How does chlorophyll function in photosynthesis?

A. by absorbing the sun's energy

B. by absorbing carbon dioxide

C. by absorbing water

The energy source for the process of photosynthesis is

A. oxygen

B. sunlight

C. carbon dioxide

D. chlorophyll

E. glucose

The energy required to start a chemical reaction is called:

A. exergonic energy

B. endergonic energy

C. kinetic energy

D. activation energy

E. catalytic energy

During adsorption of sunlight by photosystems, H+ ions are generated. Where do they come from? What are they used for?

A. water; they help form sugar

B. from the breakdown of sugar; they help form water

C. from carbon dioxide; they help dissolve NaCl

Why is consuming on a sugar-free diet, without reducing overall caloric intake, not necessarily effective?

A. all food groups feed into the respiration pathway

B. our body builds sugar from excess protein and fat

C. extra sugar is stored in our blood stream

Which polymer serves as the information storage molecule for cells?

A. Carbohydrate

B. Nucleic acid

C. Protein

D. Lipids

ATP contains

A. three phosphate groups

B. two phosphate groups

C. three nitrate groups

D. phenylalanine

This sequence represents the non-template strand of the entire transcribed region (i.e., the first G is +1) of the ILTCD gene (which is the “I Love The Central Dogma” gene):

5’GAGATTCGATGGTAAGTCTCATTGCGTCCTGAGTCCTAATTTAAATAAAGCCTTTGTAATACAGGGCAATAAAGGCCTACGC 3’

1. What are the sequences of each of the three possible introns in this provided sequence.
2. If the first hexanucleotide is used for 3’ end processing, how many exons will the final mRNA contain?
3. If a regulatory protein sat down on the first hexanucleotide and blocked it, describe what will now happen to make the new RNA, beginning with the skipping of this hexanucleotide. Be sure to indicate how many exons would be in this new final mRNA.
4. Write out the coding sequence (from the initiator codon to the stop codon) for the shorter of the two mRNAs, and then write out the amino acid sequence it codes for.
5. How many tRNAs will be needed to translate this protein?
6. If this gene is a housekeeping gene, but the regulatory protein mentioned in ## (let’s call it CPSF-blocker) was only active in neurons, which mRNA would you find in neurons, and which one would you find in liver cells?
7. The expression of CPSF-blocker is regulated by a regulatory transcription factor – why would you expect this regulatory transcription factor to interact with a HAT protein in neurons?