Explain the following:

• How many lenses do human eyes have and what are they called? How do they work to show us objects both close and far away? (Remember that simple glass lenses only have one focal length, unlike our eyes.) What happens as we age?
• How do humans perceive color? Can our brains be fooled into thinking we see a color (let’s say yellow) when we are not actually looking at yellow light? (Hint: This relates to TV and computer screens.)

Discuss the eyes of other animals—let’s say cats, flies, and hummingbirds. What do these animals’ eyes do better than humans’? Why does the animal benefit from these different abilities? Does the animal lack visual abilities that humans have?

Biology/ anatomy of the human body

1. Briefly discuss three structural and two functional characteristics common to the stomach, urinary bladder, and vagina.

2. Why is litmus, which detects changes in pH, an appropriate reagent to use when monitoring the effects of enzymes on lipid digestion?   

3. A drop of Patient X’s blood is mixed separately with Anti-A serum; Anti-B serum; and Anti-Rh serum. No agglutination (clumping) was observed. What is Patient X’s blood type?

4. One ml. of amylase, and one ml. of the starch solution are added to a test tube and incubated in a boiling water bath for five minutes. Five drops of iodine solution are then added to the test tube producing a dark blue / black color. Explain.

What is the basic reaction by which biological monomers form polymers?

A. hydrolysis

B. dehydration

C. mechanical displacement

If the environment surrounding a cell has a lower concentration of dissolved substances than the cell, the

A. environment is isotonic to the cell

B. environment is hypertonic to the cell

C. cell will not experience a net gain or loss of water

D. environment is hypotonic to the cell.

E. cell will die

Cell theory states that

A. life is spontaneously generated

B. New cells come only from pre-existing cells

C. cells can form from non-organic material

In a neutral atom, protons are always

A. equal to the electrons

B. equal to the neutrons

C. more than the electrons

D. less than the electrons

Water is best described as which of the following?

A. an ion

B. a non-polar molecule

C. an atom

D. a polar molecule

What allows a cell to maintain it shape?

A. the cell takes up water to remain round

B. the Golgi apparatus

C. the cytoskeleton

How do eukaryotic cells form tissues?

A. they are each either positively or negatively charged and are attracted to each other

B. their cell membranes fuse

C. they connect via the extracellular matrix

The main reason that cellular respiration needs to occur step by step instead of a single, big reaction is

A. cells don't store enough oxygen

B. cells don't have many mitochondria.

C. too much energy would be released for the cell to harness

D. cells produce the enzymes needed for cellular respiration very slowly

Isotopes of the same element are different from one another in that they have a different number of

A. neutron

B. electrons

C. protons

The energy to power the Calvin cycle comes from

A. cellular respiration

B. the light reactions of photosynthesis

C. oxygen

Which of the following can be broken down into intermediate products that enter cellular respiration?

A. Proteins

B. Lipids

C. Carbohydrates

D. All of these.

Name three organelles that are unique to plant cells.

A. mitochondria, nucleus, ribosomes

B. Golgi apparatus, mitochondria, endoplasmic reticulum

C. cell wall, central vacuole, chloroplast

If a cell has a greater concentration of dissolved substances than its surrounding environment, the cell

A. is hypertonic to the environment

B. is isotonic to the environment

C. is hypotonic to the environment

D. will not experience a net gain or loss of water

E. will die

In animal cells the primary organelle that generates molecules of ATP is the

A. ribosome

B. lysosome

C. Golgi body

D. mitochondrion

The structure that easily distinguishes a plant cell from an animal cell is

A. chloroplasts

B. nucleus

C. plasma membrane

D. mitochondria

When a plant becomes dried out

A. stomata (leaf pores) close, decreasing gas exchange

B. stomata open, decreasing gas exchange

C. stomata close, increasing gas exchange

D. stomata open, increasing gas exchange

Which is the main component of cell membranes?

A. Cholesterol

B. Sucrose

C. proteins

D. Phospholipids

The molecule that absorbs sunlight for photosynthesis is

A. oxygen

B. carbon dioxide

C. glucose

D. chlorophyll

E. sunlight

A cell produces 36 ATPs per glucose, however, if you calculated the total energy in a glucose molecule, 90 ATPs should be generated. Why is this so?

A. Some of the energy is destroyed

B. Some of the energy is used to do work in the cell

C. Some energy is lost as heat

Organic molecules are best defined as chemical compounds that contain

A. carbon

B. carbon and oxygen

C. carbon and hydrogen

The first stage of cellular respiration, called ___________, takes place in the cytoplasm of the cell and needs no oxygen.

A. glycolysis

B. citric acid cycle

C. photorespiration

D. oxidation

The products of cellular respiration are

A. carbon dioxide, glucose, and water

B. glucose, water, and ATP

C. glucose, carbon dioxide, and ATP

D. oxygen, ATP, and water

E. carbon dioxide, water, and ATP

The second energy shell of an atom contains a maximum of ________ electron(s).

A. one

B. two

C. four

D. eight

Making and breaking molecules in the body require the aid of ____________ to help the reactions begin

A. heat

B. oil

C. enzymes

D. blood

The term "functional" is used in the phrase "functional group" because it describes a group of atoms

A. that react a certain way with other molecules

B. that make the entire molecule hydrophobic

C. that are organic

What is an enzyme?

A. a protein that facilitates a reaction

B. a protein that supplies water for hydrolysis reactions

C. a protein that absorbs water during dehydration reactions

The organelle that carries out photosynthesis in plants is the

A. chloroplast

B. mitochondria

C. ribosome

D. chlorophylllysosome

What kind is it when one atom takes an electron from another atom?

A. ionic

B. covalent

C. hydrogen

How do we dispose of the carbon derived from the glucose that is metabolized during respiration?

A. via our urine

B. by breathing out

C. it is broken down in lysosomes

What kind of reaction is photosynthesis?

A. exergonic

B. kinetic energy

C. endergonic

D. potential energy

E. equilibrium

The enzyme that forms a transmembrane channel in mitochondria and phosphorylates ADP

A. a carrier protein

B. acetyl CoA

C. ATP synthase

Diffusion

A. requires energy

B. utilizes proteins to move molecules across a membrane

C. moves molecules against a concentration gradient

D. cannot occur without a membrane present

E. does not require energy

The Calvin cycle

A. produces three-carbon chains from CO2

B. produces ATP

C. degrades carbon chains

What is energy?

A. the capacity to do work

B. what holds an atom's nucleus together

C. the decay of neutrons

Eukaryotes such as animal and plants cells differ from prokaryotes in that prokaryotes

A. lack protein

B. lack DNA

C. lack a nucleus

What is G3P? What is it used for?

A. it is the first product of photosynthesis; used to make all polymers

B. it is formed following use of ATP, and functions as a carrier

C. it closes leaf pores and prevents the leaf from drying out

The prokaryotic structure that would protect a cell from drying out

A. cell wall

B. nucleus

C. plasma membrane

Although water has no overall charge, how and why does it form hydrogen bonds?

A. it is slippery

B. it is polar

C. it is liquid

How do the cells in one individual recognize each other as “self” and the cells of a transplanted organ as “not self”?

A. the cells of each individual have unique transmembrane recognition proteins

B. each individual has unique DNA

C. each individual has a unique cell wall

Entropy is

A. order

B. complexity

C. disorder

D. Both order and disorder are correct

E. Both complexity and disorder are correct

Glycolysis takes place in the _____________ and the citric acid cycle and electron transport chain take place in the ___________.

A. cytoplasm; endoplasmic reticulum

B. mitochondria, chloroplast

C. cytoplasm; mitochondria

D. mitochondria; cytoplasm

If an atom has an outer shell that is full it is

A. highly reactive

B. highly likely to combine with other atoms

C. highly unlikely to combine with other atoms

Reactions that tend to go on their own, releasing energy, are called:

A. endergonic

B. exergonic

C. catalytic

D. productive

How does chlorophyll function in photosynthesis?

A. by absorbing the sun's energy

B. by absorbing carbon dioxide

C. by absorbing water

The energy source for the process of photosynthesis is

A. oxygen

B. sunlight

C. carbon dioxide

D. chlorophyll

E. glucose

The energy required to start a chemical reaction is called:

A. exergonic energy

B. endergonic energy

C. kinetic energy

D. activation energy

E. catalytic energy

During adsorption of sunlight by photosystems, H+ ions are generated. Where do they come from? What are they used for?

A. water; they help form sugar

B. from the breakdown of sugar; they help form water

C. from carbon dioxide; they help dissolve NaCl

Why is consuming on a sugar-free diet, without reducing overall caloric intake, not necessarily effective?

A. all food groups feed into the respiration pathway

B. our body builds sugar from excess protein and fat

C. extra sugar is stored in our blood stream

Which polymer serves as the information storage molecule for cells?

A. Carbohydrate

B. Nucleic acid

C. Protein

D. Lipids

ATP contains

A. three phosphate groups

B. two phosphate groups

C. three nitrate groups

D. phenylalanine

This sequence represents the non-template strand of the entire transcribed region (i.e., the first G is +1) of the ILTCD gene (which is the “I Love The Central Dogma” gene):

5’GAGATTCGATGGTAAGTCTCATTGCGTCCTGAGTCCTAATTTAAATAAAGCCTTTGTAATACAGGGCAATAAAGGCCTACGC 3’

1. What are the sequences of each of the three possible introns in this provided sequence.
2. If the first hexanucleotide is used for 3’ end processing, how many exons will the final mRNA contain?
3. If a regulatory protein sat down on the first hexanucleotide and blocked it, describe what will now happen to make the new RNA, beginning with the skipping of this hexanucleotide. Be sure to indicate how many exons would be in this new final mRNA.
4. Write out the coding sequence (from the initiator codon to the stop codon) for the shorter of the two mRNAs, and then write out the amino acid sequence it codes for.
5. How many tRNAs will be needed to translate this protein?
6. If this gene is a housekeeping gene, but the regulatory protein mentioned in ## (let’s call it CPSF-blocker) was only active in neurons, which mRNA would you find in neurons, and which one would you find in liver cells?
7. The expression of CPSF-blocker is regulated by a regulatory transcription factor – why would you expect this regulatory transcription factor to interact with a HAT protein in neurons?

A 28-year-old female is hospitalized after being kicked in the left kidney during a soccer game. She is admitted to the critical care unit for observation. The nurse knows that one of the most important assessments of kidney and fluid status is the patient’s weight. In the critical care unit, weight is monitored __________. a. As needed b. Once per shift c. Daily d. Weekly The patient starts to deteriorate and the practitioner wants to accurately measure the patient’s body fluid status. Which of these values can be used to accurately assess the fluid volume status? (choose all that apply) a. Central venous pressure b. Intracranial pressure c. Pulmonary artery occlusion pressure d. Cardiac index e. Pulse oximetry f. Mean arterial pressure Diagnostic Procedures The practitioner also orders some lab work to be collected on the patient. One of the tests ordered is a serum creatinine. What is creatinine? a. A byproduct of protein and amino acid metabolism b. A byproduct of muscle and normal cell metabolism c. The concentration or dilution of vascular fluid and measures the dissolved particles in the serum d. Measures how well the kidneys remove creatinine in the urine One of the other labs the practitioner orders is a blood urea nitrogen

For each question, please explain how you got the answer.

1. The major function of RNA polymerase's sigma factor is
A) recognition of the translational stop sequence
B) recognition of the transcriptional start sequence
C) recognition of the transcriptional stop sequence
D) recognition of the translational start sequence
E) None of these are correct

2. WHere is the amino acid attached to a tRNA molecule?

A) 3′-hydroxyl of an adenine containing residue of 3’ end of tRNA
B) 5′-hydroxyl of a uridine containing residue of 3’ end of tRNA
C) 5′-hydroxyl of a guanine containing residue of 3’ end of tRNA
D) 3′-hydroxyl of a cytosine containing residue of 3’ end of tRNA
E) 2′-hydroxyl of a guanine containing residue of 3’ end of tRNA

3. Functions of RNA polymerase in E. Coli include
A) searching for promoter sites.
B) unwinding short stretches of DNA.
C) detecting termination signals.
D) searching for promoter sites and detecting termination signals.
E) All the answers are correct.

4. Actinomycin D inhibits transcription by:
A) binding to the DNA template by intercalation
B) binding to the RNA polymerase
C) binding to rho protein
D) Binding to the sigma subunit
E) none of the above

Answer all please

38. Which of the following inhibits the release of aldosterone?

a. low potassium

b. ACTH( adrenocorticotropic hormone)

c. Angiotensin 2

d. ANP( atrial natriuretic peptide)

12. which of the following substances CAN NOT be absorbed by the digestive system?

a. amino acid

b. triglyceride

c. monosaccgaride

d. Na+

0. growth hormone is anabolic for muscle and bone

a. true

b. false

40. which of the following is the correct function of PARATHYROID HORMONE?

a. increases blood calcium

b.increases blood phosphate

c. increases protein synthesis

d. ALL of the above

22. Lactose intolerance causes bloating and flatulence due to the absence of lactose dehydrogenase. Lactose is then consumed by microorganisms. The flatulence is generated by which portion of the digestive system?

a. stomach

b. small intenstine

c. Pancreas

d. Liver

E. Large intestine

36. The Adrenal Cortex secretes;

a. aldosterone

b. cortisol

c. DHEA(androgens)

d. all of the above

4. The peritoneum is:

a. a serous membrane surrounding and protecting abdominal organs

b. a connective tissue ligament attaching the liver to the stomach

c. the adventitia surrounding and protecting pancreas, duodenum and esophagus

d. an adipose layer storing nutrients for the abdominal organs

1)     What is the main activity of the colon?

1. Reabsorbing water from the guts into the circulatory system

2. Absorbing water from the circulatory system to excrete from the body

3. Absorbing cellulose and glucose into the circulatory system

4. Absorbing amino acids and cellulose into the circulatory system

5. Killing off bacteria on the digested food

2)     Which of the following is important in inflammation?

1. Contraction of actin, myosin, and thrombosthenin

2. Increased permeability of capillaries

3. Activation of platelets

4. Antibody activation

5. Superoxide and hydrogen peroxide

3)     When oxygen-rich blood passes through a capillary bed in poorly-oxygenated tissue, what happens?

1. Hemoglobin delivers carbon dioxide to the tissue and picks up oxygen waste

2. Hemoglobin changes shape and much of the oxygen unbinds from the hemoglobin

3. Hemoglobin leaves the capillary and enters the tissue to deliver oxygen

4. Hemoglobin enters the capillary to carry carbon dioxide away from the tissue

5. Hemoglobin changes shape and most of the carbon dioxide unbinds from the hemoglobin

4)     If a person with type-O blood (the host) receives blood from a type-A donor, what are the consequences?

1. There is no clotting because there are no antigens on the donor’s type-A blood

2. Both A and B are true

3. The type-A donor blood clots because of the anti-B antibodies in the host’s body

4. The type-A donor blood clots because of the anti-A antibodies in the host’s body

5. There is no clotting because there are no antibodies in the host’s type-O blood

5)     Which of the following statements best explains how the amount of water inside alveoli remains small?

1. The lymphatic system drains fluids from the alveoli

2. There are large amounts of proteins in the water inside the alveoli, which dilutes the water

3. There are large amounts of proteins in the interstitium, causing water to leave alveoli via osmosis

4. The fluid in the alveoli is passed into the esophagus

5. The question is wrong; the alveoli have large amounts of water in them

6)     Which of the following statements about hydrochloric acid in the stomach is FALSE?

1. Begins the process of breaking down fats

2. Kills many pathogens that enter the stomach

3. It is responsible for activating pepsinogen into pepsin

4. Its production results in an increase in bicarbonate in the blood

5. Denatures proteins in the stomach

7)     A protein designed to attach to one kind of invading structure (protein, carbohydrate, or other structure or chemical that identifies the invader) is:

1. Lymphocyte

2. Rh factor

3. Antibody

4. Antigen

5. Lysosome

8)     Which of the following statements about T-lymphocytes is true?

1. They are responsible for manufacturing antibodies

2. Some kinds of T-lymphocytes bind to invaders, puncture them, and poison them

3. They are manufactured in the bone marrow

4. Each T-lymphocyte can react to dozens of different antigens

5. They are related to humoral immunity, and not cell-mediated immunity

9)     When an action potential is inhibited, which of the following statements describes the voltage change?

1. Neurotransmitters are not produced in adequate amounts to carry on an action potential

2. Sodium ions are drawn into the axon and not released

3. Too much neurotransmitter is produced, causing the action potential to damage the axon

4. A greater voltage change is required because the resting voltage is unusually negative

5. A smaller voltage change is required because the resting voltage is close to zero

10)   Which of the following type of white blood cells (leukocytes) moves via amoeboid locomotion?

1. Erythrocytes

2. Lymphocyte

3. Basophils

4. Platelets

5. Macrophages

11)   When a person sees a car driving on the road, and simultaneously hears the motor, the two sensory inputs can be combined to form a more complete understanding of the situation. This is an example of:

1. Afferent and efferent interaction

2. Chemosensitivity

3. Partial pressure

4. Integrative function

5. Facilitation

12)   During exercise, the blood flow to the lungs increases by:

1. Decreased pressure in the pulmonary arteries

2. Greater pressure from the left ventricle of the heart

3. Greater number of open capillaries

4. More rapid contractions of the diaphragm

5. Slow, strong contraction of the diaphragm

Imagine that you’ve cloned something that you think is a cadherin, but you know very little about it (and hopefully nobody knows anything about it, otherwise it wouldn’t be “research”). You think it is attached to the cytoskeleton, hypothetically through its cytoplasmic tail. Your goal is to identify the part(s) of the cytoplasmic tail that is/are responsible for binding. Luckily, if you’ve cloned a gene, it is easy to make sub-clones that have specific portions of the polypeptide strand deleted. This is usually denoted by “delta” (ΔCx would be missing region #x of the cytoplasmic tail).

To achieve this goal, you would use a technique called immunoprecipitation, followed by SDS-PAGE (western blotting). The new part is immunoprecipitation, but do not worry; below the problem setup is a video for more info on this technique – which is like an add-on to the beginning parts of the SDS-PAGE/western procedure that you are already familiar with.

Basically, you use an antibody that binds to your cadherin (you can design an antibody for it, once you know the DNA sequence from the cloning step) to “pull down” your cadherin. Anything directly attached to your cadherin though, will also get pulled down with your antibody. Then you can throw away all of the other cell components – next you release the proteins from the antibody and make a liquid out of this “precipitated protein” that you pulled down – and finally you load the liquid on an SDS-PAGE gel just as we did with the “total protein” from the cytoplasm of the yeast cells. The difference (compared to what we did in lab) is that if we now use another antibody (like anti-GFP) at the end of the procedure to find the detectable proteins in our experimental system – only other proteins that were pulled down with the cadherin could possibly show up, not just any-and-all proteins that contain GFP that were in the cell lysate (liquid cell mash). Assume that we have GFP tags and antibody labelling abilities, for all candidate binding partners of the cadherin.

From the results, you can see that three proteins pull down. An approximately 110 kilodalton (kDa), a 97 kDa, and an 80 kDa protein all seem to bind with our cadherin (based on the “intact” experiment on the left; with cells that express the normal cadherin that can bind to everything that it normally wants to bind). Answer the questions below regarding the other experiments. Use panel (B) to understand what is in the lanes (the thin parts are the regions deleted, TM means “transmembrane”, the numbers are not relevant but they correspond to the number of amino acids that are deleted).

Linear Diagram of

our Cadherin

1. Which region (give a number 6, 7, 8, 9 or 10) is responsible for binding to the 97 kDa partner of the cadherin?

2. How do you explain the fact that deleting region #6 abolishes all three binding interactions? Think of protein structure/function from the in-person classes as well as the ECM lecture about cadherins (what would be the role of the transmembrane region in the overall protein structure and its ability to bind to partners).

3. Explain how the results from mutant ΔC9 (in which all three binding sites are deleted) is different than the explanation in part ii. In other words, where does the 110 kDa protein bind, and where does the 80 kDa protein bind on the cadherin? How do you explain the results from lanes 2 and 5 being the same, even though the experiments were different?

4. mOsT EXtreme ScIEntIfIc cHaLLeNge: How do you explain the results in lane 6, which seem to suggest that mutant ΔC10 still has binding to the 97 kDa partner – even though mutant ΔC10 is missing regions 7, 8, 9, and 10? Again, think of protein structure/function – and be creative.

Economic laws have been true throughout human history. As an example, consider the following passage, from Professor Samaddar’s lectures on the economy of Ancient India:

“Weaving in India has been encouraged from time immemorial... As is the case now-a-days, labourers working overtime were given extra payment... and special rewards were given for working on holidays.” (p.117)

Using a supply and demand diagram in the market for labour, clearly explain why Indian workers working overtime or during holidays were paid extra