Mrs da Vinci is an elderly patient who is admitted to a Brisbane hospital suffering dehydration, a urinary tract infection and a number of skin tears and lesions on her body resulting from multiple falls. Her mobility is compromised and there is evidence of dementia. Upon being admitted to hospital Ms da Vinci expressed an immediate desire to return home, but the health care team do not believe this can safely be achieved. Her urinary tract infection is severe and requires medication. In addition, she has several lesions which are septic and require dressing and antibiotic treatment; and she is still dehydrated. The team is strongly of the view that Mrs da Vinci requires medical treatment before it would be safe for her to leave hospital. They believe that without treatment Mrs da Vince’s health will deteriorate and she will very likely suffer serious and permanent health issues which could result in her death. However, if Mrs da Vinci receives treatment she will be likely to recover well and be able to return home within a few days.
Registered Nurse Mona has spoken at length to Mrs da Vinci, who told the nurse that she does not want any medical treatment; she just wants to go to her home where she has lived for the past 55 years. Mrs da Vinci said she knows her way around her house and is friendly with her neighbours. She also said to the nurse, “my squadron will be there most of the time and they will assist me with any medication. I also have my cat Muggins, and he will look after me.”
Mrs da Vinci was a member of the Royal Australian Airforce during her youth and made significant contributions during wartime. She frequently refers to the friends she made and the exciting times she had as a young girl in the Airforce. Sadly, she is the last surviving member of her squadron, although lately she has been referring to them as if they are still alive and present.
Mrs da Vinci has two children, Leonardo (the eldest) and Valencia. Both her children live in Brisbane and have regular contact with their mother. They are concerned about their mother and want to ensure she receives the best medical treatment possible. Mrs da Vinci’s husband passed away many years ago; however, she is very close to her neighbour, a widower, Mr Angelo. They spend a lot of time together having cups of tea and exchanging stories. Mr Angelo has expressed a desire for Mrs da Vinci to return home. Mrs da Vinci has not executed an advance health directive, nor has she appointed an enduring power of attorney. A guardian has not been appointed.
RN Mona is concerned about who should make the decision about whether Mrs da Vinci should be immediately discharged or remain in hospital to receive medical treatment, and how that decision should be reached.
Apply the ethical and legal decision-making framework to this scenario.

please apply QLD, Australian framework and ethical QLD standards

it is for nursing assignment

Please use C++ and linked list to solve this problem

Linked list 1 -> 3 -> 4 -> 5-> 6 ->7

replaceNode( 5 , 6) // Replace 5 with 6

    result 1 -> 3 -> 4 -> 6 -> 6 ->7

Base code

#include <iostream>

using namespace std;

class Node {
public:
    int data;
    Node *next;

    Node(int da = 0, Node *p = NULL) {
        this->data = da;
        this->next = p;
    }
};

class LinkedList {
private:
    Node *head, *tail;
    int position;
public:
    LinkedList() { head = tail = NULL; };

    ~LinkedList() {
        delete head;
        delete tail;
    };

    void print();
    void Insert(int da = 0);

}

void LinkedList::Insert(int da) {
    if (head == NULL) {
        head = tail = new Node(da);
        head->next = NULL;
        tail->next = NULL;
    } else {
        Node *p = new Node(da);
        tail->next = p;
        tail = p;
        tail->next = NULL;

}

}

int main() {
    cout << "Hello World!" << endl;
    LinkedList l1;
    l1.Insert(1);
    l1.Insert(3);
    l1.Insert(4);
    l1.Insert(5);

    l1.Insert(6);

    l1.Insert(7);

    l1.print();

   l1.replaceNode( 5 , 6)

   l1.print();
    cout << "The End!" << endl;
    return 0;
}

    }

}

In analyzing hits by bombs in a past war, a city was subdivided into 457 regions, each with an area of 0.25-km². A total of 356 bombs hit the combined area of 457 regions. The Poisson distribution applies because we are dealing with the occurrences of an event (bomb hits) over some interval (a region with area of 0.25-km².

In analyzing hits by bombs in a past war, a city was subdivided into 457 regions, each with an area of 0.25-km². A total of 356 bombs hit the combined area of 457 regions. The Poisson distribution applies because we are dealing with the occurrences of an event (bomb hits) over some interval (a region with area of 0.25-km².

oxytocin
increases the muscle contraction in the uterus
promotes lipolysis
increases urine output
inhibits the contraction of the uterus

which of the following organs is affected by the thyroid hormone?
brain
spleen
testes
liver

which of the following is true of glugoneogenesis?
it uses carbohydrates to form glucose
it increases glucose levels
it breaks down glucose into lipids
it is the conversion of glucose to amino acids
B and C

which of the following is not a category of endocrine gland stimulation?
enzyme
humoral
hormonal
neural (nervous system stimulation?

growth hormone
promotes the release of IGF (insulin-like growth factors)
secretion results in a decreased muscle mass (size)
stimulates the release of GHRH
is released by the hypothalamus

the release of thyroid hormone
leads to a decrease in oxygen levels
leads to a decrease in the breathing rate
leads to a decrease in heart rate
leads to an increase in glycogenesis

which is a true statement?
thyrotropin-releasing hormone stimulates the release of oxytocin
thyrotropin-releasing hormone inhibits the release of oxytocin
thyrotropin-releasing hormone stimulates the release of thyroid hormone
thyrotropin-releasing hormone stimulates the release of thyroid stimulating hormone

lipid soluble hormones
never cross the plasma membrane
cross the nuclear envelope (nucleus)
travel in the bloodstream using no transport protein
are not soluble in fats

the receptor hormone complex
only uses water soluble hormones
never uses lipid soluble or water soluble hormones
only uses lipid soluble hormones
can use both water soluble hormones and lipid soluble hormones

1 Substrate that use to produce liver ketone body

2.Intermediate that find in both carbohydrate and fatty acid degradation.

3.Which molecule is the causative of acidosis in human?

4.Amino acid that used to control urea cycle.

5.Intermediate which play an important role in rate limiting step of fatty acid synthesis and degradation.

1. The term "double helix" as it is used to describe DNA refers to the the fact that DNA is comprised of 2 DNA strands that are twisted together to form a spiral.

   True

   False

2. The genotype ratio compares the number of times each genotype would be produced in the offspring of a mating.

   True

   False

3. If one strand of a segment of DNA has a base sequence of A-G-C-A-T, its complementary strand would be T-C-G-T-A.

   True

   False
   

4. t RNA:

   		carries amino acids
   		is where an anti-codon would be found
   		both A and B are true statements
   		neither A or B are true statements

Among the alleles for the gene responsible for cystic fibrosis that have been identified, one mutant has been identified in which three amino acids in the middle of the protein sequence are changed.  What change in the DNA sequence of the gene could cause such a mutation? (Choose the best answer):

Select one:

a. a single base pair deletion

b. insertion of three adjacent base pairs

c. a single base pair substitution

d. a single base pair insertion and a single base pair deletion a short distance 3' to the insertion

e. deletion of three adjacent base pairs

1. Given the following prokaryote sequence of DNA:
   
   Identify if any promoter sequences are present in DNA SEQ1 (Highlight/Underline these in the sequence)
   
   Predict the mRNA sequence that would arise from this DNA sequence.
   
   Identify the ribosome binding site, start and stop codons (if present). (Highlight/Underline these in the sequence).
   
   Predict the sequence of the peptide that would arise from the predicted mRNA sequence using the genetic code table (see Codon usage table).
   
   Based on your knowledge of the properties of amino acids speculate on the properties of the predicted peptide (e.g. charge, hydrophobicity, aromaticity)
   
   5’TAAAATCACCTTTCATTGACACCACAATCACATCTCTACGTATAATGAATTTAAAGCGGAGGCAAATTTGCCCCCCAATGCTTTTTGTCGACTTCGACTTTAAATGCTCAAAAGGAGGCAAATGAAAACTT 3’