Kindly write a two page summary of the content below including important details. Thank you. kindly paraphrase as well

Abstract Representing the 60 trillion cells that build a human body, a sperm and an egg meet, recognize each other, and fuse to form a new generation of life. The factors involved in this important membrane fusion event, fertilization, have been sought for a long time. Recently, CD9 on the egg membrane was found to be essential for fusion [1], but sperm-related fusion factors remain unknown. Here, by using a fusion-inhibiting monoclonal antibody [2] and gene cloning, we identify a mouse sperm fusion related antigen and show that the antigen is a novel immunoglobulin superfamily protein. We have termed the gene Izumo and produced a genedisrupted mouse line. Izumo −/− mice were healthy but males were sterile. They produced normal-looking sperm that bound to and penetrated the zona pellucida but were incapable of fusing with eggs. Human sperm also contain Izumo and addition of the antibody against human Izumo left the sperm unable to fuse with zonafree hamster eggs. Identification of Izumo To identify factors involved in sperm–egg fusion, we used a monoclonal antibody, OBF13, against mouse sperm that specifically inhibits the fusion process [2]. The antigen was identified by separation of the crude extracts from mouse sperm by two-dimensional gel electrophoresis and subsequent immunoblotting with the monoclonal antibody. We named the antigen ‘Izumo’ after a Japanese shrine dedicated to marriage. The identified spot was analyzed by liquid chromatography tandem mass spectrometry (LC–MS/MS), and ten peptides that were 100% identical to a part of the sequence listed in the RIKEN full-length database were found. The registered DNA sequence was confirmed by sequencing after polymerase chain reaction with reverse transcription (RT–PCR) with total RNA prepared from the testis. A human homologue was found as an unverified gene in the NCBI database. The gene encodes a novel immunoglobulin superfamily (IgSF), type I membrane protein with an extracellular immunoglobulin-like domain that contains one putative glycosylation site (Fig. 1a). Mouse Izumo was shown to be a testis (sperm)-specific 56.4-kDa antigen by western blotting with a polyclonal antibody raised against recombinant mouse Izumo (Fig. 1b). Izumo was also detectable as a 37.2-kDa protein by western blotting of human sperm with anti-human Izumo antibody (Fig. 1c). Izumo was not detectable on the surface of fresh sperm. Coinciding with the fact that mammalian sperm are incapable of fertilizing eggs when ejaculated and that fertilization occurs only after an exocytotic process called the acrosome reaction, both mouse and human Izumo became detectable on sperm surface only after the acrosome reaction (Fig. 1d, e). This would probably be because Izumo is not localized on plasma membrane of fresh spermatozoa but is hidden under plasma membrane and accessible after the acrosome reaction, as occurs with CD46 on mouse sperm [3]. Figure 1 Identification and characterization of Izumo. a, Izumo is a typical type I membrane glycoprotein with one immunoglobulin-like domain and a putative N-glycoside link motif (Asn 204). b, Izumo was detected exclusively in testis and sperm by western blotting. The tissues examined are, from left to right: brain, heart, thymus, spleen, lung, liver, muscle, kidney, ovary, testis and sperm. The arrowhead indicates mouse Izumo protein. c, Western blotting analysis of human Izumo protein from human sperm. The arrow indicates human Izumo protein. d, Immunostaining of Izumo in sperm from an acrosin-promoter-driven transgenic mouse line that has enhanced green fluorescent protein in the acrosome. Izumo was not detected in fresh sperm with intact acrosomes expressing EGFP (indicated by green arrows), but was revealed on acrosome-reacted (non-green fluorescent) sperm (stained red, shown by white arrowheads), when stained with the polyclonal antibody against mouse Izumo. e, Human sperm were also stained with polyclonal anti-human Izumo antibody (red). Acrosome-reacted human sperm (stained green with anti-CD46 antibody) were reactive to the antibody against human Izumo but the same antibody did not react to acrosome-intact (CD46-negative) sperm. Scale bar, 10 mm. 40 ANNUAL REPORT OF OSAKA UNIVERSITY—Academic Achievement—2004-2005 Establishment of Izumo-deficient mice To address the physiological role of Izumo in vivo we generated Izumo-deficient mice by homologous recombination. An Izumo targeting construct was designed to replace exons 2–10 with a neomycin-resistant gene (neor ). Both the targeting event in D3 embryonic stem cells and the germline transmission of targeted genes were confirmed by Southern blot analysis. In the homozygous mutant mice, the full-length messenger RNA and the Izumo protein were not detected. Because the disruption of a gene can cause a concomitant increase or decrease in some related genes, we examined CD46, sp56, CD55, CD147, and ADAM2, which were reported to be involved in sperm–egg interactions. We could not find a significant change in these protein levels in sperm after the deletion of Izumo gene. The fecundity of Izumo-deficient males Izumo −/−mutant mice were healthy and showed no overt developmental abnormalities. Izumo -/- females demonstrated normal fecundity. Izumo +/− males also showed normal fertilizing ability. However, Izumo −/− males were sterile despite normal mating behaviour and ejaculation, with normal vaginal plug formations. After observation of 28 plugs, nine pairs of Izumo −/− male and wild-type females were kept for another 4 months but no pregnancies were observed. In at least four different cases of gene knockouts that resulted in male sterility attributed to impaired zonabinding ability, the sperm also failed to migrate into the oviduct. However, disruption of Izumo did not cause any defect in sperm migration into the oviduct (data not shown, and there was no reduction of sperm motility in Izumo −/− sperm motility was measured 120 min after incubation by computer-aided sperm analysis (CASA; mean; s.e.m.=81.7±7.7% in Izumo +/− sperm and 77±8.9% in Izumo −/− sperm)). The sterile nature of Izumo −/− sperm was shown in the in vitro fertilization system (Fig. 2a). The impaired fertilization step undoubtedly followed zona penetration because sperm penetrated the zona pellucida and accumulated in the perivitelline space of the eggs (Fig. 2b). Fusion ability in Izumo-deficient sperm Syngamy can be considered to occur to two stages: binding of the sperm plasma membrane to that of the egg, and actual membrane fusion. Izumo −/− sperm were capable of binding to the plasma membranes of eggs whose zona pellucida had been mechanically removed [4] (Fig. 2c). In this system, the Izumo +/− sperm incubated for 2 and 6 h fused to eggs in approximate ratios of 4.5 and 6 sperm per egg, respectively, but no Izumo −/− sperm fused with eggs (Fig. 2c). Sperm can not fuse with eggs unless the former have undergone the acrosome reaction. To verify the acrosomal status of Izumo −/− sperm, we stained the sperm accumulated in perivitelline spaces with the MN9 monoclonal antibody, which immunoreacts only to the equatorial segment of acrosomereacted sperm [5]. The staining indicated that the Izumo −/− sperm had undergone the acrosome reaction (Fig. 2b) but failed to fuse with eggs. Development of eggs after intracytoplasmic sperm injection (ICSI) with Izumo-deficient sperm Because no offspring were fathered by Izumo −/− male mice, it was unclear whether the defect was limited to fusion or extended to later developmental stages. To address this question, we used ICSI to insert Izumo −/− sperm directly into the cytoplasm of wild-type eggs and bypass the fusion step. Eggs injected with Izumo −/− sperm were successfully activated and the fertilized eggs were transplanted into the oviducts of pseudopregnant females. The eggs implanted normally and the resulting embryos developed appropriately to term with rates similar to those of heterozygous mice. Human Izumo is also involved in sperm-egg fusion Sperm–egg fusion is known to be less species-specific than sperm–zona interaction. For example, human sperm can not penetrate the hamster zona pellucida but they can fuse with zona-free hamster eggs, and this system (zona-free hamster-egg sperm penetration test) has been used for the assessment of human sperm fertility. We first examined the contribution of mouse Izumo in a zona-free hamster-egg sperm penetration assay. As indicated in Fig. 3a, the mouse Izumo was essential not only in the homologous fusion system but also for heterologous fusion with hamster eggs. Similarly, when the anti-human Izumo polyclonal antibody was added to the incubation mixture, no fusion was observed, whereas the sperm treated with control IgG fused with eggs at an average of 5.9±0.7 sperm per egg. The total numbers of eggs observed were 23 and 29, respectively (n=3). These results indicated that human Izumo is involved in the fertilization process in human sperm (Fig. 3b). Rescued fertility of Izumo-deficient male by transgene The phenotypes of gene knockout mice are not always related Figure 2 Male infertility caused by Izumo disruption. a, In vitro fertilization of sperm from Izumo +/−and Izumo −/−mice. Unlike Izumo +/−, the eggs inseminated with Izumo −/− sperm had many sperm on their zona pellucida, owing to the failure of sperm–egg fusion that probably leads to the absence of zona-reaction to lessen the sperm-binding ability of the zona pellucida. b,Upper panel, accumulation of many sperm in the perivitelline space of the eggs recovered from the females mated with Izumo −/− males. Lower panel, sperm in perivitelline space labelled with acrosome reacted, spermspecific monoclonal antibody MN9. c, Fused sperm stained by Hoechst 33342 preloaded into the egg. The arrowheads show the fused sperm. to the disrupted genes but are sometimes caused by disruption of a neighbouring gene. To examine whether the phenotype was directly derived from the lack of Izumo on sperm, we performed a rescue experiment by crossing Izumo −/− mice with transgenic mouse lines generated to express Izumo by using the testis-specific calmegin promoter [6]. The sterile phenotype was rescued with the transgenically expressed Izumo on mouse sperm (Fig. 4). Discussion In the search for sperm surface proteins that function in sperm–egg plasma-membrane binding and fusion, various candidates such as DE, CD46, equatorin, Sperad and SAMP32 have been reported. ADAM family proteins are given the most attention for their possession of a putative fusion peptide (ADAM1) and disintegrin domain (ADAM2 and ADAM3). None of the mice possessing disrupted ADAM1a, ADAM2 and ADAM3 show a significant defect in the ability to fuse with eggs [7-9], but do show an impairment of sperm–zona binding ability. Similarly, CD46 disruption does not diminish fusion [3]. In contrast, CD9 on the egg surface is essential for the fusing ability of eggs [1] and some indications for the involvement of the binding of integrins to CD9 are postulated in reference to sperm–egg fusion. However, the disruptions of the most probable candidate integrin α6β1 cause no major influence on the fusing ability of eggs. Thus, for several years, postulated fertilization mechanisms were repeatedly changed as a result of gene disruption experiments. This suggests that the essential nature of the candidate gene must be judged after observing the phenotype of the gene-disrupted mice. In this context, Izumo is the first sperm membrane protein shown to be essential for fusion. It is not yet known whether sperm Izumo interacts with egg CD9, as occurs with placental IgSF protein PSG17; neither do we know why the localization of Izumo after acrosome reaction is not limited to the 41 Osaka University 100 Papers : 10 Selected Papers ANNUAL REPORT OF OSAKA UNIVERSITY—Academic Achievement—2004-2005 Figure 4 Transgene to express mouse Izumo under the control of calmegin promoter. a, The locations of primers A to E were indicated in this figure. b, lane 1; Izumo +/− mouse with intrinsic Izumo, lane 2 and 3; Izumo −/− mouse with transgenically expressed Izumo and Izumo His-tag, respectively. c, Litter size obtained by mating male mice with C57BL/6 wild-type mice. The group numbers are equal to those shown in b. The numbers in parentheses indicate the numbers of matings. References 1. Miyado, K. et al., Requirement of CD9 on the egg plasma membrane for fertilization. Science, 287, 321-4 (2000). 2. Okabe, M. et al., Capacitation-related changes in antigen distribution on mouse sperm heads and its relation to fertilization rate in vitro. J Reprod Immunol, 11, 91-100 (1987). 3. Inoue, N. et al., Disruption of mouse CD46 causes an accelerated spontaneous acrosome reaction in sperm. Mol Cell Biol, 23, 2614-22 (2003). 4. Yamagata, K. et al., Sperm from the calmegin-deficient mouse have normal abilities for binding and fusion to the egg plasma membrane. Dev Biol, 250, 348-57 (2002). 5. Manandhar, G. & Toshimori, K., Exposure of sperm head equatorin after acrosome reaction and its fate after fertilization in mice. Biol Reprod, 65, 1425-36 (2001). 6. Ikawa, M. et al., Calmegin is required for fertilin alpha/beta heterodimerization and sperm fertility. Dev Biol, 240, 254-61 (2001). 7. Cho, C. et al., Fertilization defects in sperm from mice lacking fertilin beta. Science, 281, 1857-9 (1998). 8. Nishimura, H., Cho, C., Branciforte, D. R., Myles, D. G. & Primakoff, P., Analysis of loss of adhesive function in sperm lacking cyritestin or fertilin beta. Dev Biol, 233, 204-13 (2001). 9. Nishimura, H., Kim, E., Nakanishi, T. & Baba, T., Possible Function of the ADAM1a/ADAM2 Fertilin Complex in the Appearance of ADAM3 on the Sperm Surface. J Biol Chem, 279, 34957-62 (2004). equatorial segment where fusion initially takes place. All we can say now is that continued study of this protein’s function will undoubtedly lead to a fuller understanding of the cell–cell fusion process in fertilization and perhaps in other somatic systems such as muscle cells or trophoblasts. The finding not only provides insight into the enigmatic fusion mechanism but also promises benefits in the clinical treatment of infertility and the potential development of new contraceptive strategies

The table below represents the production function for Hawg Wild, a small catering company specializing in barbecued pork. The numbers in the cells represent the number of customers that can be served with various combinations of labor and capital.

a.Is this production function a short-run or long-run production function? How can you tell?

b.Suppose that Hawg Wild employs 5 units of capital and 2 workers. How many diners will be served?

c.Suppose that Hawg Wild employs 5 units of capital and 2 workers, but that the owner, Billy Porcine, is considering adding his nephew to the payroll. What will the marginal product of Billy’s nephew be?

d.Notice that when Hawg Wild uses 1 unit of capital, the marginal product of the fifth unit of labor is 16. But when Hawg Wild uses 5 units of capital, the marginal product of the fifth unit of labor is 43. Does this production function violate the law of diminishing marginal product of labor? Why or why not?

e.Suppose that Hawg Wild employs 5 units of capital and 2 workers, but that the owner, Billy Porcine, is considering adding another meat smoker to the kitchen (which will raise the amount of capital input to 6 units). What will the marginal product of the smoker be?

f. Hawg Wild employs 5 units of capital and 2 workers. Billy is considering the choice between hiring another worker or buying another smoker. If smokers cost $8 and workers $12, then at the margin, what is the most cost-effective choice for Billy to make?

1. Assuming the underlying demand for cases of O Be Joyful beverages is a linear function of O Be Joyful per-case price and state income (000s), use the data to obtain least squares estimates for each state's beverage demand function (three separate regressions). Report each estimated demand function in your memo. Please feel free to attach summary results to your memo. Your memo should stand alone, however, as communication. Do not ask the reader to go to attachments to justify any argument.
   1. Estimate own-price and income elasticities for each state and interpret the results. (Please see three tables below)

Wisconsin

1. It was discovered that COVID19 RNA is a sense (+) strand. If the RNA sequence that codes for the 5 viral genes begins with 5’ GGGUACAUGGUAGCC….3’, the starting amino sequence is:

a) N-terminal Tyr-His-Arg- C-terminal

b) N-terminal Gly-Tyr-Met-Val-Ala- C-terminal

c) N-terminal Val-Ala- C-terminal

d) N-terminal Pro-Met-Tyr-His-Arg-   C-terminal

e) N-terminal Met-Tyr-His-Arg-   C-terminal

2. Which of the following enzymes has the highest functional error?

a) RNA Polymerase 1

b) DNA Polymerase 1

c) DNA Polymerase 3

d) RNA Polymerase 2

e) DNA Polymerase 2

3. After several rounds of replication, if COVID19 RNA changes from 5’ GGGUACAUGGUAGCCCCCCGUCGAG...3’ to 5’ GGGUACAUGGUAGCCCCCCGUCGCCCCGUAG….3’ which of the following describes the above event:

a) a multi-points mutation occurred

b) an insertion mutation occurred

c) an inversion mutation occurred

d) a point-series mutation occurred

1) The WILDTYPE DNA/gene has the base sequence:   

5’GTACTGCAT3’ (the antisense strand of the gene is shown)

The gene has undergone a mutation. The mutant DNA/gene has the base sequence:

5’GTACTCCAT3’ (the mutation is in BOLD)

based on this information, answer the following

1a)What is the base sequence of mutant mRNA? Label the ends of the mRNA

1b) this mutation is most likely to be caused by:

a. soot b. analogues c. X-Ray d. RNA polymerase e. ribosome (pick one)

1c). What is the amino acid sequence specified by the mRNA transcribed from the mutant DNA? What do we call this type of mutation? Is it likely to change the protein more drastically than a mutation caused by removing a base from the gene?

1d). (not related to the information given above) which of the following is unlikely treat bacterial infections

a. animal virus b. phages c. RNA polymerase inhibitors d. repressors e. ribosome inhibitors (pick one)

1e). (not related to information given above) can DNA replication result in genetic change. explain

During the 1980s, most of the world's supply of lysine was produced by a Japanese company named Ajinomoto. Lysine is an essential amino acid that is an important livestock feed component. At this time, the United States imported most of the world's supply of lysine—more than 30,000 tons—to use in livestock feed at a price of $1.65 per pound. The worldwide market for lysine, however, fundamentally changed in 1991 when U.S.-based Archer Daniels Midland (ADM) began producing lysine—a move that doubled worldwide production capacity. Experts conjectured that Ajinomoto and ADM had similar cost structures and that the marginal cost of producing and distributing lysine was approximately $0.70 per pound. Despite ADM's entry into the lysine market, suppose demand remained constant at Q = 208 − 80P (in millions of pounds). Shortly after ADM began producing lysine, the worldwide price dropped to $0.70. By 1993, however, the price of lysine shot back up to $1.65. Use Oligopoly to provide a potential explanation for what happened in the lysine market. Support your answer with appropriate calculations.

Please explain with details!!! THANK YOU!

3.

1. Consider the following normal sequence:

Gly-leu-arg-gln-cys-ile-phe

And the following mutant proteins. What is the nature of each mutation? Describe what happens in each case.

1. Gly-leu-arg-gln                     
2. Gly-leu-arg-arg-cys-ile-phe
3. Gly-phe-lys-thr-met-gln-ile

2. Epidermolytic hyperkeratosis is an autosomal dominant condition that produces scaly skin. It can be caused by a missense mutation that substitutes a histidine (his) amino acid with an arginine (arg). Write the mRNA codons that could account for this change, and indicate if it is a transition or transversion.

c. Individuals with mutations in the GJB2 gene are deaf. The most common mutation in a population is a deletion of this gene’s 235^th nucleotide, which is a C. The normal GJB2 protein is made in the cytoplasm and then moves to the cell membrane. In patients with the most common mutant allele, the GJB2 protein remains in the cytoplasm and is quickly degraded. This mutation is likely classified as a:

1. Missense mutation
2. Nonsense mutation
3. Gain-of-function mutation
4. Loss-of-function mutation

While perusing the scientific literature late one night, you come across a report that a protein called Thingamajig is thought to be involved in the development of antibiotic resistance, an emerging global health crisis. This putative involvement appears to involve an interaction with another protein, Whosiewhatsit. You would like to study Thingamajig, and its interaction with Whosiewhatsit, but neither protein has been cloned.

a) How would you set out to study these proteins and their interaction? Describe in general terms (a flowchart, for example), filling in the details once this framework is assembled. To get you started, how would you obtain the information necessary to express and purify these proteins, and how would you manipulate this information?

b) Assuming Thingamajig is positively charged and Whosiewhatsit is negatively charged, what purification approach might you use to purify each of them independently? What approach might you take to purify the complex of the two?

c) What approach would you take to identify the amino acid residues — in both Thingamajig and Whosiewhatsit — that underlie their interaction with one another?

Define the terms

33.   Demand-side economics
34.   Keynesianism
35.   Historical Utilitarianism
36.   Pragmatism
37.   Anti-egalitarianism
38.   Human perfectibility
39.   Socialism
40.   Marxism
41.   Intergovernmental organization (IGO)
42.   International law
43.   Bilateral treaty
44.   Multilateral treaty
45.   North Atlantic Treaty Organization (NATO)
46.   North American Free Trade Agreement (NAFTA)