(b) After the newly formed protein leaves the ribosome the first amino acid in the protein, methionine, is removed. What specific type of enzyme catalyzes this reaction?
(c) When benzo[a]pyrene is formed in the burning of meat. What substance(s) in the meat is the source of the aromatic rings in the product?
(d) How do drug manufacturers make most drugs water soluble?
(e) What is the name of the reaction that would convert a RNA nucleoside into a DNA nucleoside?
In: Biology
Implement a queue - C programming, please read the instruction carefully and implement queue.c using dynamic array structure given dynarray.h and dynarray.c below
The second ADT you'll implement for this assignment is a queue.
For this assignment, the interface for the queue (i.e. the structures and the prototypes of functions a user of the queue interacts with) is already defined for you in the file queue.h. Your first task in this assignment is to implement definitions for the functions that comprise this interface in queue.c.
Note that you may not modify the interface definition with which you are provided. Specifically, do not modify any of the already-defined queue function prototypes. We will use a set of tests to verify your implementation, and if you change the queue interface, it will break these tests, thereby (negatively) affecting your grade. Beyond the already-defined interface, though, feel free to add any additional functions or structures your queue implementation needs.
The queue functions you'll need to implement are outlined briefly below. All of these functions use a type called struct queue, which is defined in queue.c and represents the queue itself. For more details, including information on function parameters and expected return values, see the documentation provided in queue.c.
queue_create() - This function should allocate, initialize, and return a pointer to a new queue structure.
queue_free() - This function should free the memory held within a queue structure created by queue_create(). Note that this function only needs to free the memory held by the queue itself. It does not need to free the individual elements stored in the queue. This is the responsibility of the calling function.
queue_isempty() - This function should return 1 if the queue is empty and 0 otherwise.
queue_enqueue() - This function should insert a new element at the back of the queue. This operation must have O(1) average runtime complexity.
queue_front() - This function should return the value stored at the front of the queue without removing it. This operation must have O(1) average runtime complexity.
queue_dequeue() - This function should dequeue a value from the queue and return the dequeued value. This operation must have O(1) average runtime complexity.
Importantly, the queue you build MUST use a dynamic array as its underlying data storage. You are provided with a dynamic array implementation in dynarray.h and dynarray.c that you may use for this purpose. Feel free to modify this dynamic array implementation as needed to implement your queue, with the constraint that you may only interact with the dynamic array implementation via its interface functions. In particular, you may not directly access or modify the fields of the dynamic array structure (struct dynarray). In other words, you may not change the fact that dynarray.h only contains a forward declaration of struct dynarray, and you may not redefine the dynamic array structure in queue.h or queue.c.
Also, note that, as with the data structures you implemented in assignment 1, values in the queue will be stored as void pointers.
dynnaray.h
/*
* This file contains the definition of the interface for a dynamic
array.
* You can find descriptions of the dynamic array functions,
including their
* parameters and their return values, in dynarray.c.
*/
#ifndef __DYNARRAY_H
#define __DYNARRAY_H
/*
* Structure used to represent a dynamic array. You may not change
the fact
* that only a forward declaration of the dynamic array structure is
included
* here. In other words, you can't define the fields of the struct
here.
*/
struct dynarray;
/*
* Dynamic array interface function prototypes. Refer to dynarray.c
for
* documentation about each of these functions.
*/
struct dynarray* dynarray_create();
void dynarray_free(struct dynarray* da);
int dynarray_size(struct dynarray* da);
void dynarray_insert(struct dynarray* da, void* val);
void dynarray_remove(struct dynarray* da, int idx);
void* dynarray_get(struct dynarray* da, int idx);
void dynarray_set(struct dynarray* da, int idx, void* val);
#endif
dynarray.c
/*
* This file contains a simple implementation of a dynamic array.
See the
* documentation below for more information on the individual
functions in
* this implementation.
*/
#include
#include
#include "dynarray.h"
/*
* This structure is used to represent a single dynamic array.
*/
struct dynarray {
void** data;
int size;
int capacity;
};
#define DYNARRAY_INIT_CAPACITY 4
/*
* This function allocates and initializes a new, empty dynamic
array and
* returns a pointer to it.
*/
struct dynarray* dynarray_create() {
struct dynarray* da = malloc(sizeof(struct dynarray));
assert(da);
da->data = malloc(DYNARRAY_INIT_CAPACITY *
sizeof(void*));
assert(da->data);
da->size = 0;
da->capacity = DYNARRAY_INIT_CAPACITY;
return da;
}
/*
* This function frees the memory associated with a dynamic array.
Freeing
* any memory associated with values stored in the array is the
responsibility
* of the caller.
*
* Params:
* da - the dynamic array to be destroyed. May not be NULL.
*/
void dynarray_free(struct dynarray* da) {
assert(da);
free(da->data);
free(da);
}
/*
* This function returns the size of a given dynamic array (i.e. the
number of
* elements stored in it, not the capacity).
*/
int dynarray_size(struct dynarray* da) {
assert(da);
return da->size;
}
/*
* Auxilliary function to perform a resize on a dynamic array's
underlying
* storage array.
*/
void _dynarray_resize(struct dynarray* da, int new_capacity)
{
assert(new_capacity > da->size);
/*
* Allocate space for the new array.
*/
void** new_data = malloc(new_capacity * sizeof(void*));
assert(new_data);
/*
* Copy data from the old array to the new one.
*/
for (int i = 0; i < da->size; i++) {
new_data[i] = da->data[i];
}
/*
* Put the new array into the dynarray struct.
*/
free(da->data);
da->data = new_data;
da->capacity = new_capacity;
}
/*
* This function inserts a new value to a given dynamic array. The
new element
* is always inserted at the *end* of the array.
*
* Params:
* da - the dynamic array into which to insert an element. May not
be NULL.
* val - the value to be inserted. Note that this parameter has type
void*,
* which means that a pointer of any type can be passed.
*/
void dynarray_insert(struct dynarray* da, void* val) {
assert(da);
/*
* Make sure we have enough space for the new element. Resize if
needed.
*/
if (da->size == da->capacity) {
_dynarray_resize(da, 2 * da->capacity);
}
/*
* Put the new element at the end of the array.
*/
da->data[da->size] = val;
da->size++;
}
/*
* This function removes an element at a specified index from a
dynamic array.
* All existing elements following the specified index are moved
forward to
* fill in the gap left by the removed element.
*
* Params:
* da - the dynamic array from which to remove an element. May not
be NULL.
* idx - the index of the element to be removed. The value of `idx`
must be
* between 0 (inclusive) and n (exclusive), where n is the number
of
* elements stored in the array.
*/
void dynarray_remove(struct dynarray* da, int idx) {
assert(da);
assert(idx < da->size && idx >= 0);
/*
* Move all elements behind the one being removed forward one
index,
* overwriting the element to be removed in the process.
*/
for (int i = idx; i < da->size - 1; i++) {
da->data[i] = da->data[i+1];
}
da->size--;
}
/*
* This function returns the value of an existing element in a
dynamic array.
*
* Params:
* da - the dynamic array from which to get a value. May not be
NULL.
* idx - the index of the element whose value should be returned.
The value
* of `idx` must be between 0 (inclusive) and n (exclusive), where n
is the
* number of elements stored in the array.
*/
void* dynarray_get(struct dynarray* da, int idx) {
assert(da);
assert(idx < da->size && idx >= 0);
return da->data[idx];
}
/*
* This function updates (i.e. overwrites) the value of an existing
element in
* a dynamic array.
*
* Params:
* da - the dynamic array in which to set a value. May not be
NULL.
* idx - the index of the element whose value should be updated. The
value
* of `idx` must be between 0 (inclusive) and n (exclusive), where n
is the
* number of elements stored in the array.
* val - the new value to be set. Note that this parameter has type
void*,
* which means that a pointer of any type can be passed.
*/
void dynarray_set(struct dynarray* da, int idx, void* val) {
assert(da);
assert(idx < da->size && idx >= 0);
da->data[idx] = val;
}
queue.h
/*
* This file contains the definition of the interface for the queue
you'll
* implement. You can find descriptions of the queue functions,
including
* their parameters and their return values, in queue.c. You should
not
* modify anything in this file.
*/
#ifndef __QUEUE_H
#define __QUEUE_H
/*
* Structure used to represent a queue.
*/
struct queue;
/*
* Queue interface function prototypes. Refer to queue.c for
documentation
* about each of these functions.
*/
struct queue* queue_create();
void queue_free(struct queue* queue);
int queue_isempty(struct queue* queue);
void queue_enqueue(struct queue* queue, void* val);
void* queue_front(struct queue* queue);
void* queue_dequeue(struct queue* queue);
#endif
queue.c
#include
#include "queue.h"
#include "dynarray.h"
/*
* This is the structure that will be used to represent a queue.
This
* structure specifically contains a single field representing a
dynamic array
* that should be used as the underlying data storage for the
queue.
*
* You should not modify this structure.
*/
struct queue {
struct dynarray* array;
};
/*
* This function should allocate and initialize a new, empty queue
and return
* a pointer to it.
*/
struct queue* queue_create() {
return NULL;
}
/*
* This function should free the memory associated with a queue.
While this
* function should up all memory used in the queue itself, it should
not free
* any memory allocated to the pointer values stored in the queue.
This is the
* responsibility of the caller.
*
* Params:
* queue - the queue to be destroyed. May not be NULL.
*/
void queue_free(struct queue* queue) {
return;
}
/*
* This function should indicate whether a given queue is currently
empty.
* Specifically, it should return 1 if the specified queue is empty
(i.e.
* contains no elements) and 0 otherwise.
*
* Params:
* queue - the queue whose emptiness is being questioned. May not be
NULL.
*/
int queue_isempty(struct queue* queue) {
return 1;
}
/*
* This function should enqueue a new value into a given queue. The
value to
* be enqueued is specified as a void pointer. This function must
have O(1)
* average runtime complexity.
*
* Params:
* queue - the queue into which a value is to be enqueued. May not
be NULL.
* val - the value to be enqueued. Note that this parameter has type
void*,
* which means that a pointer of any type can be passed.
*/
void queue_enqueue(struct queue* queue, void* val) {
return;
}
/*
* This function should return the value stored at the front of a
given queue
* *without* removing that value. This function must have O(1)
average runtime
* complexity.
*
* Params:
* queue - the queue from which to query the front value. May not be
NULL.
*/
void* queue_front(struct queue* queue) {
return NULL;
}
/*
* This function should dequeue a value from a given queue and
return the
* dequeued value. This function must have O(1) average runtime
complexity.
*
* Params:
* queue - the queue from which a value is to be dequeued. May not
be NULL.
*
* Return:
* This function should return the value that was dequeued.
*/
void* queue_dequeue(struct queue* queue) {
return NULL;
}
In: Computer Science
The bacterium Escherichia coli (or E. coli) is a single-celled organism that lives in the gut of healthy humans and animals. When grown in a uniform medium rich in salts and amino acids, these bacteria swim along zig-zag paths at a constant speed of 20 um/s. The figure shows the trajectory of an E. coli as it moves from point A to point E. Each segment of the motion can be identified by two letters, such as segment BC.
What is the magnitude of the bacterium's average velocity for the entire trip?
In: Physics
How can both clay and ice crystals enhance chemical reactions necessary to form complex organic molecules?
| A. |
Both have highly reactive surfaces that help to lower the energy of activation for reactions that form complex organic molecules. |
|
| B. |
Both trap the water needed in reactions that result in organic molecules. |
|
| C. |
Both have the necessary elements to form amino acids. |
|
| D. |
Both have microscopic spaces that help to concentrate reagents, facilitating reactions involving those reagents. |
In: Chemistry
The base sequence of a polynucleotide chain is given as follows. This is the template strand of a DNA molecule. Please answer the questions following the base sequence.
3’-TAC GGG CTA CAA CTT AAC AGA CCA ATC-5’
In: Biology
For each fragment of DNA provided:
circle the promoter region
transcribe the DNA into mRNA
indicate the directionality on both the DNA fragment and mRNA
underline the mRNA start codon (if applicable)
circle the mRNA stop codon (if applicable)
build the polypeptide (if applicable) use the short form of the amino acids.
illustrate and label the bond type that holds the polypeptide together
provide an ordered list of the tRNA anticodons that were required to build the polypeptide
#1: GCCCTCGGCAAATTAATAGATCTGTACAACGCCTCGCAAATAACTGCG
#2:GCCCGATGCATTAATTAACCGTACCTTGATGCTAGGTGTATCTTA
Please help!
In: Biology
You decide you are going to decipher codons of an unknown mRNA transcript. In a test tube you mix the unknown mRNA template, tRNA with all 20 amino acids, and a large concentration of ribosomal subunits. You end up producing 3 distinct polypeptides of poly- asp, poly-thr and poly-arg. What is the sequence of the unknown mRNA? Write the first 6 letters of the sequence, starting by the 5' end. DO NOT write the numbers, just the nucleotide letters.
Answer:
In: Biology
In: Anatomy and Physiology
5. List all major structures and organs involved in the flow of blood through the hepatic portal system. Begin with major veins of the intestines and end with the inferior vena cava.
6. Outline the major events occurring during the digestion and absorption of lipids. Begin with emulsified fats in the duodenum and end with absorption of micelle in lacteals
7. Outline the major events occurring during the digestion and absorption of proteins. Begin with protein digestion in the stomach and end with absorption of amino acids in the intestinal capillaries.
In: Anatomy and Physiology
is it a phosphate system, slow glycolysis, fast glycolysis, beta oxidation, or transamination/deamination?
1. protein will be used as fuel is depleted of
fuel
2. can be enhancing by eating more red meat.
3. recovered in 60 min.
4. 1 atp per one substrate used
5. results in co2 and h20
6. complete depletion of carbs
7. predominant system for long distance endurance between 60 to
70%
8. clear lactate fast than it is produced
9.predominant system for long distance endurance between 85 to
90%
10. allows high intensity after carb have been depleted
11. pyruvate is lactate
12. predominant system for long distance endurance between 70 to
80%
14. underlying system for all activity
15. greatest quantity of atp
16.use fuel outside muscle
17. 36 to 40 atp production
18. 2 atp per one substrate
19. swapping of amine groupd betwren a keto acid and amino
acid
In: Biology