In cactus, the relationship between Gene S and Gene N is known to be epistatic. Gene S controls the sharpness of spines in a type of cactus. Cacti with the dominant allele, S, have sharp spines, whereas homozygous recessive ss cacti have dull spines. At the same time, the second gene, N, determines whether or not cacti have spines. Homozygous recessive nn cacti have no spines at all. Briefly explain why this genetic interaction is considered epistasis. Which gene is considered epistatic to the other?

Briefly describe the characteristics of eukaryotic telomeres that cause them to replicate differently than the rest of the chromosome. What will be the result of this replication challenge over a lifetime of cell duplications? How might the enzyme telomerase affect cellular aging?

Vesicles in eukaryotic cells can move along microtubules, using the ATPases kinesin and dynein. The figure at right depicts a microtubule aster nucleated from a centrosome, with a transport vesicle moving along the microtubule. The + and – ends of that microtubule are indicated.

A. Which microtubule motor protein would be used to transport the vesicle away from the centrosome?

B. Which motor protein do you think would power:

1. Vesicle transport from the ER to the Golgi?

2. Vesicle transport from the Golgi to the plasma membrane?

Phosphorylation of nuclear lamins regulates their assembly and disassembly during mitosis. You add a drug to cells that are undergoing mitosis that inhibits the activity of an enzyme that dephosphorylates nuclear lamins. Briefly, predict will happen to these cells. Why?

Vesicles in eukaryotic cells can move along microtubules, using the ATPases kinesin and dynein. The figure at right depicts a microtubule aster nucleated from a centrosome, with a transport vesicle moving along the microtubule. The + and – ends of that microtubule are indicated.

A. Which microtubule motor protein would be used to transport the vesicle away from the centrosome?

B. Which motor protein do you think would power:

1. Vesicle transport from the ER to the Golgi?

2. Vesicle transport from the Golgi to the plasma membrane?

Phosphorylation of nuclear lamins regulates their assembly and disassembly during mitosis. You add a drug to cells that are undergoing mitosis that inhibits the activity of an enzyme that dephosphorylates nuclear lamins. Briefly, predict will happen to these cells. Why?

Description: Cellular respiration is the process that allows your body to harvest a huge amount of energy from a single glucose. In fact, it's so efficient that you get 30 ATP for every 1 glucose molecule you eat. This exercise is going to break down exactly where each ATP comes from.

Instructions: raw each metabolic step which generates an ATP, NADH or FADH2, include the names, structures and enzyme for each step. From there, look up the conversion rates from NADH and FADH2 to ATP and calculate exactly how 30 ATP are formed. Also include any step which uses an ATP (this will count against the total ATP formed).

Submit the structures and enzymes as well as ATP calculation

Coupled Reactions.

Let us assume that 2 reactions are connected as stated below;

A + Pi <------> BPi Keq at 37 C is 0.02 and

S<----->C + Pi Keq at 37 C is 1000

a) Determine the Standard state energy value (ΔG0) for each reaction then determine the value for the coupled reaction. (hint – you know the Keq value – how would the related equation be set up?)

b) Do you think this reaction would proceed spontaneously at STP conditions? Why or Why not?

c) Would a coupled reaction proceed faster in the presence of an enzyme versus a situation where the reactants alone were dissolved in water in a beaker? Explain at a molecular level. Pictures would help. Would the ΔG be different in these two situations?

11. You discover a new population of ashy geckos on the Dry Tortugas that have emigrated from southern Florida. You collect the genetic data in the table below for the enzyme cytochrome oxidase (cox), shown in the table below. a. What are the allelic frequencies for the Dry Tortugas population? b. What are the population’s genotypic frequencies? c. Is this population in H-W equilibrium? d. Offer an explanation (1-2 sentences) for your answer to 11c.

The sequence below represents the DNA sequence of the polylinker (also called the multiple cloning site) on a plasmid, with the dots (...) on either side representing the continuing DNA on either side of the polylinker

.............5' CACTTAAGCCTGCAGCGTTAGCGT 3'.........
..............3' GTGAATTCGGACGTCGCAATCGCA 5'..........

The plasmid is cut with the restriction endonuclease Pst1, which recognizes the following sequence:

-------- -- -5' CTGCAG 3'

and which cuts between the A and the G nucleotides.

A. After cutting the plasmid with Pst1, how many DNA fragments would be generated?

B. What would be the sequence of the sticky ends? 5'_________3'

C. C. If the sequence was cut by a different restriction enzyme that recognized the same sequence as Pst1 but cut between the T and the G, what would be the sequence of the sticky ends? 5'_________3'

QUESTION 8 1. Are all bacteria competent for transformation?

a. Yes they are all competent b. No, some bacteria in nature can do it and in the lab scientists can force bacteria to be competent. o c. No and nothing can be done about it d. no only yeast are competent 10 points

QUESTION 9 1. Which enzyme "glues" DNA fragments together?

a. DNA Ligase b. DNA Recombinase c. all these enzymes d. DNA Reductase 10 points

QUESTION 10 1. Which of these is an example of xenotransplantaion

a. Using a pig retina to treat eye disease in a man b. Using stem cells to treat cancer c. cloning a pet d. Kidney donation from a father to a son

1. Explain the renin - angiotensin- aldosterone system (RAAS). Be sure to describe the role of each organ, hormone, and enzyme involved, as well as elaborate on why such a system is necessary even though the kidney is able to regulate glomerular filtration rate through vasoconstriction and vasodilation of the afferent and efferent arterioles.

2). This man has a long history of infectious bronchitis. Why would this chronic smoker be especially susceptible to infections of the bronchi?

3). Explain why this man has bloody sputum (hemoptysis).

4). More than 90% of all cancers (any type: skin, breast, esophageal, lung, etc.) arise from epithelial tissue. Why do you suppose this is the case?

5). if there is an increase in systemic blood pressure, the kidneys respond by causing:

I understand the first half just not the both half.

Sportz, Inc., manufactures athletic shoes and athletic clothing for both amateur and professional athletes. The company has two product lines (clothing and shoes), which are produced in separate manufacturing facilities; however, both manufacturing facilities share the same support services for information technology and human resources. The following shows total costs for each manufacturing facility and for each support department.

The total costs of the support departments (IT and HR) are allocated to the production departments (clothing and shoes) using a single rate based on the following:

Information technology: Number of IT labor-hours worked by department
Human resources: Number of employees supported by department

Data on the bases, by department, are given as follows:

What are the total costs of the production departments (clothing and shoes) after the support department costs of information technology and human resources have been allocated using (a) the direct method, (b) the step-down method (allocate information technology first), (c) the step-down method (allocate human resources first), and (d) the reciprocal method?

Assume that all of the work of the IT department could be outsourced to an independent company for $97.50 per hour. If Sportz no longer operated its own IT department, 30% of the fixed costs of the IT department could be eliminated. Should Sportz outsource its IT services?