In: Anatomy and Physiology
1-What is true of people with O blood type?
|
|||
|
|||
|
|||
|
2-Which of the following is true of sphingolipids?
|
|||
|
|||
|
|||
|
3-Which of the following is true of triacylglycerol AND glycerophospholipids?
|
|||
|
|||
|
|||
|
In: Biology
Draw the structure of D-H-Y-K amino acids at PH=7. a) At PH 8, the net charge on the peptide will be....? b) At PH 6, the net charge will be...? c)The PI of this peptide is PH, or equal to PH? I drew the structure but I have no idea how to calculate the net charge at any pH
In: Chemistry
|
Part A: The following sequence encodes a protein in the virus genome: 5’ tctaaaatgtcagatgtaaagtgcacatcagtagtcttactctcagttttgtaacaactc 3’ 3’ agattttacagtctacatttcacgtgtagtcatcagaatgagagtcaaaacattgttgag 5’ How many amino acids long is the protein? |
|
Part B: A base pair substitution (ie. a point mutation) that introduces a nonsense mutation could be introduced to the sequence encoding the protein in Part A. True/False |
In: Biology
consider the structure of the neurotransmitters: Acetylcholine, Noradrenaline, Adrenalin, dopamine, glycine, serotonin, y-aminobutyric acid and glutamic acid and suggest what type of binding interactions could be involved in binding them to a receptor binding site, and identify possible amino acids in the binding site which could take place in these binding interactions
In: Biology
A single drop of water has the fate of ending up one day in urine. Once it has become filtrate, it contains glucose, urea, H+, amino acids, Na+, Cl-, K+, and, of course, water. Discuss what happens with each of these, within the context of the three main functions of the nephron (filtration, reabsorption, and secretion).
In: Anatomy and Physiology
1. Enterochromaffin-like cells of the gastric mucosa can be triggered to release histamine. Histamine, in this case, causes nearby parietal cells of the stomach lining to produce hydrochloric acid. The effect of histamine on parietal cells would best be described as a(n) ________.
| a. paracrine |
| b. autocrine |
| c. exocrine |
| d. second messenger |
2. Which of the following statements is true of amino acid-based hormones?
| a. They are lipid soluble. |
| b. They are synthesized from cholesterol. |
| c. They require a receptor in the plasma membrane. |
| d. They cross the plasma membrane. |
3. Cyclic AMP (cAMP), diacylglycerol (DAG), inositol triphosphate (IP3), and calcium ions can serve as second messengers.
| a. True |
| b. False |
4. Which of the following is NOT a component of the cyclic AMP signaling mechanism?
| a. G protein |
| b. hormone receptor |
| c. effector enzyme |
| d. steroid |
5. The effect of a hormone on a target cell may be decreased by the presence of ________.
| a. plasma membrane receptors |
| b. synergistic hormones |
| c. antagonistic hormones |
| d. permissive hormones |
6. Hormones that bind to plasma proteins ________.
| a. are usually water soluble |
| b. must also bind to plasma membrane receptors |
| c. are usually made of amino acids |
| d. are usually synthesized from cholesterol |
7. Which of the following is correctly matched?
| a. zona reticularis gonadocorticoids |
| b. zona glomerulosa epinephrine and norepinephrine |
| c. adrenal medulla glucocorticoids |
| d. zona fasciculata mineralocorticoids |
Please answer the questions with a, b, c or d as the answers wont really need explanations. Thanks
In: Anatomy and Physiology
One of the many remarkable enzymes in the human body is carbonic anhydrase, which catalyzes the interconversion of carbon dioxide and water with bicarbonate ion and protons. If it were not for this enzyme, the body could not rid itself rapidly enough of the CO2 accumulated by cell metabolism. The enzyme catalyzes the dehydration (release to air) of up to 107 CO2 molecules per second. Which components of this description correspond to the terms enzyme, substrate, and turnover number?
In: Chemistry
1.
a) Name the following (with full names): (a) The amino acid without a primary amino group
(b) An amino acid that could form a salt bridge with an Asp residue in a protein interior:
(c) The amino acid that contains sulfur that doesn’t make disulfide bonds:
(d) Name one of the three amino acids that have hydroxylated R groups:
e) Draw the structure of the tetrapeptide SKYP at a pH of 5, making sure you include the structures of all R groups and all charges and clearly indicate where they originate. Clearly indicate the net charge of the tetrapeptide. If you can’t remember one of the side chains just use R but try to indicate the charge regardless. furthermore, What would be the net charge on the molecule at pH 1 and 12? Don’t redraw the peptide, but do indicate the charges on each residue at the different pH’s so part marks can be assigned. It may help to know the following pKa values: N-terminal amino group: 8 C-terminal carboxyl group: 3.1 Lys R-group: 10.8 Tyr R-group: 10.9
In: Biology
Alternative splicing can generate more than one polypeptide from a single gene by Select one: a. cleaving the polypeptide at different positions. b. changing the order of exons included in the mature mRNA. c. omitting specific exons from the mature mRNA. d. incorporating different amino acids at a single codon position.
In: Biology