Both glyceraldehyde 3-phosphate and dihydroxyacetone phosphate are substrates for the enzyme triose phosphate isomerase. In a study by Knowles et al the k_M for glyceraldehyde 3-phosphate was determined to be 0.47mM with a Vmax of about 410 uM/min. Whereas, for the substrate dihydroxyacetone phosphate the k_M was determined to be 0.97 mM and the Vmax was about 41 uM/min. (Biochem J 129 (2) 1972:301-310). Triose phosphate isomerase has a relatively weak affinity for _______

A. glyceraldehyde 3-phosphate because the k_M is lower in comparison

B. dihydroxyacetone phosphate because the k_M is higher in comparison

C. glyceraldehyde 3-phosphate because the Vmax is higher in comparison

D. dihydroxyacetone phosphate because the Vmax is lower in comparison

Consider the following paragraph.  

Superoxide dismutase is an enzyme that detoxifies a free radical called superoxide.a This radical is responsible for causing injury during reperfusion after a heart attack, and is also thought to play a role in Parkinson’s Disease.b Depending on what organism the protein is found in, it occurs either as a dimer or tetramer of identical subunits.c The subunits are mostly a-helical with some β-sheet near the C-terminus.d A metal binding site for manganese, iron, nickel or copper/zinc is composed of residues from both the N-terminus and the C-terminus.e These residues are: His-26, His-81, Asp-167, His-171.f

Write the letter of the sentence(s) represent primary structure, secondary structure, tertiary structure, and quaternary structure in the above paragraph? You may or may not use all the letters. Explain your choices.

Primary structure =

Secondary structure =

Tertiary structure =

Quaternary structure =

You have worked on YFE1 (your favorite enzyme!) for awhile and know it is a serine/threonine kinase important in a crucial signal transduction pathway in the cell (not related to metabolism). You have developed in vitro and in vivo assays for its activity. You have the genetic tools to overexpress the protein and to produce mutants of the protein that show decreased function while still expressing the protein as well as RNAi to silence the gene. You know that eliminating the gene function leads to impaired cells that do not survive well because the pathway it is in is very important in the cell. Another researcher just published results showing that knocking out the YFE1 gene in mice leads to pups that survive less than 10 days. They found during day 1, the pups developed hyperglycemia which they believe was the cause of their early deaths. There has been no previous evidence YFE1 played a role in glucose metabolism; none of your work has ever shown a link to the pathway, but you acknowledge that you have never done experiments that directly test this. Given these new results, you want to see if you can figure out if YFE1 could be involved in glucose metabolism. Write a hypothesis. Outline the experiments you would conduct to test your hypothesis. Define the cells you will examine if that is your choice of experiments. (in particular, the tissue source). You may do any in vitro or in vivo assay – no whole animal studies. [Don't just say you are going to run a microarray. Tell me what cells you would use as control and experimental. Don't just say you are going to run a Northern blot - tell me what sample you are going to run it on and against what gene or sequence your probe will be. However, you should not write a Method section description of the experiment.]

Consider a continuous culture of Bacillus subtilis bacteria, which are used to produce the enzyme amylase during the growth phase. The relevant parameters for growth of this bacteria are μ_MAX = 0.88 hr^-1, Y_X/S = 0.5 gdw/gr substrate, S₀ = 4.0 gr substrate/L, and the Monod constant K_S = 0.3 gr/L, while the protein yield during growth phase is Y_P/X (aka product parameter α) = 0.12 g protein/gdw. The chemostat is operated at a dilution rate that is 60% of the maximum growth rate. Using this information, what is the steady state rate of product formation in the chemostat culture, in units of grams protein/L-hour?

1. The enzyme that unwinds the DNA double helix is called
   1. DNA gyrase                c. helicase
   2. primase                       d. ligase
2. RNA polymerase has
   1. 5’- 3’ exonucleases
   2. 3’- 5’ exonucleases
   3. both exonucleases
   4. no exonucleases

3. In the synthesis of RNA the addition proceeds by    
   1. attack of the 3’OH to the a phosphate of the incoming NTP
   2. attack of the 3’OH to the a phosphate of the incoming dNTP
   3. attack of the 5’OH to the a phosphate of the incoming NTP
   4. attack of the 5’OH to the a phosphate of the incoming dNTP                     

4.    The RNA transcript is identical to the
   1. nontemplate strand of DNA
   2. coding strand of DNA but T is replaced by U
   3. coding strand of DNA but U is replaced by T
   4. template strand

5.   The specific binding sites for RNA polymerase on DNA are called
   1. core subunits              
   2. transcripts
   3. introns
   4. promoters

The restriction enzyme ApaI recognises and cleaves the sequence GGGCC^C (^ indicates where the DNA is cleaved).

You previously determined the size of the product amplified in the PCR. which is the region between the bold section

TGGGCTAGGTGTAGGGGTCCTGAGTTCCGGGCTTTGCTACCCAGCTCTTGACTTCTGT

TTCCCGATTTTA AATGAGCAGTTTGGACTAAGCCATTTTTAAGGAGAGCGATGGGGAGG

GCTTCCCCCTTAGCACAAGGGCAGCCCTGGCCCTGGCTGAAGCCCAACCCCAACCTC

CAAGACTGTGAGAGGATGGGGACTCATCCCTGGAGGAGGTGCCCCTCCTGGTATTGAT

AAAGAATGCCCTGGGGAGGGGGCATCACAGGCTATTTGAACCAGCCCTGGGACCTTG

GCCACCTCAGTGTCACTGGGTAGGGGGAACTCCTGGTCCCTTGGGTATATGGAAGGTA

TCAGCAGAAAGCCAGCACTGGCAGGGACTCTTTGGTACAATACCCAGCATGCATGCTG

TGCCAGGGGCTGACAAGGGTGCTGTCCTTGGCTTCCCCATTTTGGAGTGGTCACTTG

CCTCTACTCCAGCCCCAGAAGTGGAAACTGAGATGATGTGTGGAGGAGAGAGCCAGC

GTTCATGTTGGGAATCTTGAGGCTCCTTTCCAGCTCTCAGATTCTGTGATGCTCAAAGG

GTGAGCTCTGTGGGCCCAGGACGCATGGTAGATGGAGCTTAGTCTTTCTGGTATCCAG

CTGGGAGCCAAGCACAGAACACGCATCAGTGTTTATCAAATGACTGAGGAAATGAATGA

ATGAATGTCTCCATCTCAACCCTCAGCCTGGTCCCTCCTTTTTTCCCTGCAGTTGGTAC

AGATGGCATTGTCCCAGTCTGTTCCCTTCTCGGCCACAGAGCTTCTCCTGGCCTCTGC

CATCTTCTGCCTGGTATTCTGGGTGCTCAAGGGTTTGAGGCCTCGGGTCCCCAAAGGC

CTGAAAAGTCCACCAGAGCCATGGGGCTGGCCCTTGCTCGGGCATGTGCTGACCCTG

GGGAAGAACCCGCACCTGGCACTGTCAAGGATGAGCCAGCGCTACGGGGACGTCCT

GCAGATCCGCATTGGCTCCACGCCCGTGCTGGTGCTGAGCCGCCTGGACACCATCCG

GCAGGCCCTG

Now, identify the ApaI site within this region. If you digest the PCR product with ApaI, how many fragments of DNA would you get, and what would be the sizes of the resulting DNA fragments (in base pairs)?

QUESTION 29 1. In Avery, MacLeod and McCarty's experiment, what enzyme was present in the mixture of R & S Strain that when injected into the mice did not result in death?

a. Protease b. All the enzymes were present c. DNASE d. RNASE

QUESTION 31

1. Frederick Griffith's experiments resulted in which of the following novel findings?

Serum glutamic oxaloacetic transaminase (SGOT) is an enzyme that elevates when the heart muscle is damaged. Assume that the population distribution of SGOT levels in adults with healthy hearts is known to be normally distributed with ? = 18.5 units/L and ? = 13.2 units/L.

a. What proportion of adults with a healthy heart have an SGOT level of above 25 units/L? (0.5pts)

b. For a sample size of ? = 40 from this population, what would be the sampling distribution of the mean SGOT level? Include the type of distribution and the values of the defining parameters. (0.5pts)

c. Now suppose you collected a sample of ? = 40 adults who recently underwent heart surgery. If the sample mean SGOT level you got was above 25 units/L, do you think that the SGOT level of people who have recently undergone heart surgery actually has a distribution with ? = 18.5 units/L? Why or why not?

For each of the following scenarios, state the appropriate null hypothesis and indicate whether the result corresponds to a Type-I error, a Type-II error, or no error. Use α=0.05. (1pt each)

a. A new method of relaxation training, which includes mediation and biofeedback, is reported to be successful at reducing high blood pressure, even though it doesn’t actually have any effect on blood pressure.

b. A study that tested if there was any relationship between a person’s heart rate and consuming a small amount of caffeine resulted in a p-value of 0.21. In truth, there is no relationship between heart rate and caffeine in this population.

c. Park officials tested if new design of bear-proof trash bins is more successful at keeping bears out than the bins they currently use. Fact is that the new design is actually more successful than the current one. Their test resulted in a p-value of 0.08.

McArdle Disease (glycogen storage disease 5) is caused by mutations in the phosphorylase enzyme in muscle. The symptoms are muscle cramps, pain, and fatigue during strenuous exercise. A) An ischemic exercise test is often used as part of the diagnostic process. This test measures lactate in the blood but is not always specific for McArdle. Explain why lactate might be a good diagnostic measurement for this disease and how its production is regulated in muscle in a normal person versus a McArdle patient. B) A patient is undergoing an ischemic exercise test and is fed 13C glucose prior to the test and then blood is drawn after the test. Explain how the following substrates would be labeled 1) alpha-ketoglutarate, 2) glucose 3) ribose, and 4) alanine. C) in patients with McArdle would you expect electron chain activity to increase, decrease, or remain the same in the muscle cell if the person is at rest? exercising?

McArdle Disease (glycogen storage disease 5) is caused by mutations in the phosphorylase enzyme in muscle. The symptoms are muscle cramps, pain, and fatigue during strenuous exercise. A) An ischemic exercise test is often used as part of the diagnostic process. This test measures lactate in the blood but is not always specific for McArdle. Explain why lactate might be a good diagnostic measurement for this disease and how its production is regulated in muscle in a normal person versus a McArdle patient. B) A patient is undergoing an ischemic exercise test and is fed 13C glucose prior to the test and then blood is drawn after the test. Explain how the following substrates would be labeled 1) alpha-ketoglutarate, 2) glucose 3) ribose, and 4) alanine. C) in patients with McArdle would you expect electron chain activity to increase, decrease, or remain the same in the muscle cell if the person is at rest? exercising?