Match each statement about pyruvate metabolism in mitochondria with the correct term.
|
|
QUESTION 14
You have a small plastic chamber with a semipermeable cellulose membrane running down the middle. This membrane contains pores that allow molecules with sizes under 10,000 daltons (Da) to pass freely. You fill one side of your chamber with water (18 Da) and the other side with an equal volume of solution containing bromophenol blue dye (670 Da) at a concentration of 4 mg/mL in water. After allowing your experimental chamber to stand overnight, you would expect to find ____________________.
|
that all the water in the chamber had moved to the side you added dye to, which was hyperosmotic |
||
|
4 mg/mL bromophenol blue solution on both sides of the membrane due to diffusion of the molecules. |
||
|
that all the dye had moved to the opposite side of the membrane, which was hypoosmotic |
||
|
2 mg/mL bromophenol blue solution on both sides of the membrane due to diffusion of the molecules. |
QUESTION 15
Fermentation pathways ____________________.
|
include an electron transport system in which molecular oxygen is not the final acceptor |
||
|
produce less ATP and more NADH than glycolysis |
||
|
cannot operate if molecular oxygen (O2) is present |
||
|
produce ATP only through glycolysis, and regenerate NAD+ |
In: Biology
1.Does each amino acid have the same chemical properties? Why or why not?
2.How do only 4 different RNA nucleotides code for 20 different amino acids?
3. How does a start codon differ from a stop codon? Do they possess any similarities
In: Biology
In: Chemistry
A. Palmitate B. Acyl-CoA C. Triacylglycerol D. cholesterol
A. Glutamine B. Leucine C. Tyrosine D. Methionine
A. True B. False
In: Biology
1) Explain how amino acids can be metabolized for energy, including deamination
2) Define what a ketone is and how it can be utilized in metabolism
In: Anatomy and Physiology
What forces stabilise this structure?
• Describe the structure of the antiparallel and parallel beta pleated sheet.
• In relation to the backbone where are the side chains of the amino acids?
In: Biology
Why don't infants suffer from sickle cell anemia?
(Need an in-depth answer that focuses on the biology, including amino acids and blood cells)
In: Biology
Below are the DNA sequences that encode the first eight amino acids for four alleles of the Adh protein in Drosophila melanogaster. Nucleotides that differ from the first sequence are shown by a lowercase letter.
ATGTCTCTCACCAACAAGAACGTC
ATGgCTCTCACCAACAAGAACGTC
ATGTCgCTCACCAACAAGAACGTC
ATGTCTtTgACCAACAAGAACGTC
a. What are the first eight amino acids for each of these four DNA sequences?
b. For each of the four polymorphic sites, indicate whether the site represents a synonymous or nonsynonymous polymorphism.
c. Synonymous polymorphisms tend to be more common than nonsynonymous ones. Why might that be?
I mostly need help with question “C.” So if anything please answer question “C”!!
In: Biology
25. If proteins were composed of only 12 different kinds of amino acids, what would be the smallest
possible codon size in a genetic system with four different nucleotides?
A) 1
B) 2
C) 3
D) 4
E) 12
26. From the following list, which is the first event in translation in eukaryotes?
A) elongation of the polypeptide
B) base pairing of activated methionine-tRNA to AUG of the messenger
C) binding of the larger ribosomal subunit to smaller ribosome subunits
D) covalent bonding between the first two amino acids
E) Both B and D occur simultaneously.
In: Biology
The protein synthesis in pro- and eukaryotic species resembles
each other to a large degree. In both pro and eukaryotic cells,
mRNA is used as template for incorporation of the correct amino
acids in the growing polypeptide chain.
a) List the main differences between mRNA from prokaryotic and
eukaryotic species
b) In contrast to prokaryotic cells, eukaryotic cells has
spliceosomes, what function do they have? and list the main steps
in the reaction
c) How many different codons code for amino acids?
d) Explain why the number of different tRNA molecules is lower,
than the number of different codons?
In: Biology