Questions
Prompt: Coronavirus (Covid-19) is an enveloped virus. Enveloped viruses like Covid-19 are referred to as being...

Prompt: Coronavirus (Covid-19) is an enveloped virus. Enveloped viruses like Covid-19 are referred to as being “enveloped” because their virus particle is surrounded by a layer that resembles a cell membrane. The “Corona” part of coronavirus comes from the appearance of the virus particles under an electron microscope. Corona refers to “crown” or “wreath.” Proteins that stick out from the surface of the virus (called spike proteins) are responsible for the crown-like appearance.

Questions 1 and 2 I need help with:

1. To get sick by Covid-19, the virus needs to enter into our respiratory tract (nose or mouth). One way we can get infected by Covid-19 is by touching an infected surface and then touching our face.
Although alcohol-containing hand sanitizer does helps to protect us against Covid-19 and has certainly received a lot of press, washing our hands with soap and water is still the best and most effective approach to protect ourselves against the virus! Soap is an amphipathic molecule.

How does soap and water help to prevent infection by Covid-19? Use the details provided above and information you learned in the class to support your answer. Your answer should include a discussion about bonds and molecular interactions.

2. Spike proteins are transmembrane proteins that stick out from the surface of the virus particle. Covid-19 uses its spike proteins to attach to the cell when it is causing an infection.

What types of amino acids would you expect to find in the spike protein within the transmembrane portion of the protein? Conversely, what types of amino acids would you find in the spike protein at the top of the spike (ie. the region that is not in the envelope)? Explain your answer.

(By types of amino acids, I am not looking for specific names of amino acids. I want to know the characteristics of the amino acids that you would expect to find in these regions).

In: Biology

Match each statement about pyruvate metabolism in mitochondria with the correct term. This product of pyruvate...

  1. Match each statement about pyruvate metabolism in mitochondria with the correct term.

    This product of pyruvate oxidation directly supplies energy to the mitochondrial electron transport system.
      

    This product of pyruvate oxidation diffuses across the lipid bilayer of the  mitochondrial inner membrane.

    This product of pyruvate oxidation enters the citric acid cycle.
      

    This is co-transported into the mitochondrial matrix along with pyruvate.
    A.

    NADH
    B.

    AcetylCoA
    C.

    CO2
    D.

    H+

QUESTION 14

  1. You have a small plastic chamber with a semipermeable cellulose membrane running down the middle. This membrane contains pores that allow molecules with sizes under 10,000 daltons (Da) to pass freely. You fill one side of your chamber with water (18 Da) and the other side with an equal volume of solution containing bromophenol blue dye (670 Da) at a concentration of 4 mg/mL in water. After allowing your experimental chamber to stand overnight, you would expect to find ____________________.

    that all the water in the chamber had moved to the side you added dye to, which was hyperosmotic

    4 mg/mL bromophenol blue solution on both sides of the membrane due to diffusion of the molecules.

    that all the dye had moved to the opposite side of the membrane, which was hypoosmotic

    2 mg/mL bromophenol blue solution on both sides of the membrane due to diffusion of the molecules.

QUESTION 15

  1. Fermentation pathways ____________________.

    include an electron transport system in which molecular oxygen is not the final acceptor

    produce less ATP and more NADH than glycolysis

    cannot operate if molecular oxygen (O2) is present

    produce ATP only through glycolysis, and regenerate NAD+

In: Biology

Question 3 The function of a protein is fundamentally based on its shape. The shape of...

Question 3
The function of a protein is fundamentally based on its shape. The shape of a protein is based on its amino acid sequence. A protein with 100 amino acids can theoretically fold into billions and billions of possible shapes, however, only one of these shapes is useful to carry out its function.
1) Briefly describe the four levels of protein folding and what influences each of them.
2) Devise a method for denaturing a given level of protein structure
3) What is a prion?
4) What is a chaperone protein?
5) Are proteins static or dynamic structures?
6) How many proteins are in the human body?
7) What is the largest protein in the human body?

Question 4
1) Which elements are liquid at room temperature?
2) What is the densest element?
4 / 4
3) What are the top 5 most abundant elements in the universe?
4) What are the top 5 most abundant elements in the Earth's Crust?
5) What are the top 5 most abundant elements in the human body?
6) What is the only letter not appearing in the periodic table?
7) How heavy is a mol of moles (the animal,use your favourite mole)?
8) What phase of matter is glass?
9) What is the most abundant biological molecule on the planet
10) Briefly describe a method of transmuting lead into gold




In: Chemistry

1.Does each amino acid have the same chemical properties? Why or why not? 2.How do only...

1.Does each amino acid have the same chemical properties? Why or why not?

2.How do only 4 different RNA nucleotides code for 20 different amino acids?

3.   How does a start codon differ from a stop codon? Do they possess any similarities

In: Biology

Fatty acids are stored in the white adipocytes in the form of ____. A. Palmitate                B....

  1. Fatty acids are stored in the white adipocytes in the form of ____.

A. Palmitate                B. Acyl-CoA               C. Triacylglycerol            D. cholesterol

  1. Which of the following amino acids has a branched side chain?

A. Glutamine B. Leucine      C. Tyrosine     D. Methionine

  1. The Cori Cycle produces net ATPs.

A. True                        B. False

In: Biology

1) Explain how amino acids can be metabolized for energy, including deamination 2) Define what a...

1) Explain how amino acids can be metabolized for energy, including deamination

2) Define what a ketone is and how it can be utilized in metabolism

In: Anatomy and Physiology

What forces stabilise this structure? • Describe the structure of the antiparallel and parallel beta pleated...

What forces stabilise this structure?

• Describe the structure of the antiparallel and parallel beta pleated sheet.

• In relation to the backbone where are the side chains of the amino acids?

In: Biology

Why don't infants suffer from sickle cell anemia? (Need an in-depth answer that focuses on the...

Why don't infants suffer from sickle cell anemia?

(Need an in-depth answer that focuses on the biology, including amino acids and blood cells)

In: Biology

Below are the DNA sequences that encode the first eight amino acids for four alleles of...

Below are the DNA sequences that encode the first eight amino acids for four alleles of the Adh protein in Drosophila melanogaster. Nucleotides that differ from the first sequence are shown by a lowercase letter.

ATGTCTCTCACCAACAAGAACGTC

ATGgCTCTCACCAACAAGAACGTC

ATGTCgCTCACCAACAAGAACGTC

ATGTCTtTgACCAACAAGAACGTC

a. What are the first eight amino acids for each of these four DNA sequences?

b. For each of the four polymorphic sites, indicate whether the site represents a synonymous or nonsynonymous polymorphism.

c. Synonymous polymorphisms tend to be more common than nonsynonymous ones. Why might that be?


I mostly need help with question “C.” So if anything please answer question “C”!!

In: Biology

25. If proteins were composed of only 12 different kinds of amino acids, what would be the smallest



 25. If proteins were composed of only 12 different kinds of amino acids, what would be the smallest

 possible codon size in a genetic system with four different nucleotides?

 A) 1

 B) 2

 C) 3

 D) 4

 E) 12


 26. From the following list, which is the first event in translation in eukaryotes?

 A) elongation of the polypeptide

 B) base pairing of activated methionine-tRNA to AUG of the messenger

 C) binding of the larger ribosomal subunit to smaller ribosome subunits

 D) covalent bonding between the first two amino acids

 E) Both B and D occur simultaneously.


In: Biology