Can you find any mutation, name the domains, if the proteins are conserved, and the amino acid sequences and in which organelle will you find the genetic material that encodes your genes.

>Pseudo-nitzschia multiseries (the homolog of the osteroccus tauri)

ATGTCTCAATCTGTATCAGAACGGACTCGAATTAAAAGTGACCGTTACGAATCTGGTGTAATCCCTTACG

CTAAAATGGGTTACTGGGATGCTTCATACACAGTAAAAACTACTGATGTTCTTGCTTTATTCCGTATCAC

ACCACAACCAGGCGTAGATCCTGTTGAAGCTGCTGCTGCAGTAGCTGGTGAATCTTCAACAGCAACTTGG

ACAGTTGTATGGACTGATTTATTAACAGCTTGTGATCGTTACCGAGCTAAAGCTTACCGTGTAGATCCAG

TTCCAAATACATCTGATGTTTTCTTTGCTTTCATCGCATACGAATGTGATTTATTCGAAGAAGGTTCTTT

ATCTAACTTAACAGCATCTATTATTGGTAACGTATTCGGTTTCAAAGCTGTATCAGCTTTACGTTTAGAA

GACATGCGTATTCCTCACTCATACTTAAAAACATTCCAAGGTCCTGCAACAGGTATCGTTGTAGAACGTG

AACGTTTAAATAAATATGGTGCTCCTTTATTAGGTGCTACAGTAAAACCAAAATTAGGTTTATCTGGTAA

AAACTACGGTCGTGTAGTATTCGAAGGTTTAAAAGGTGGTTTAGACTTCTTAAAAGATGATGAGAACATT

AACTCTCAACCATTCATGCGTTGGAGAGAGCGTTTCTTAAACTGTATGGAAGGTATTAACCGTGCATCTG

CTGCTACAGGAGAAGTAAAAGGTTCTTACTTAAACGTTACAGCTGCTACTATGGAAGAAGTAATCAAACG

TTGTGAGTACGCTAAAGAAGTAGGTTCTGTTATCGTTATGATCGATTTAGTTATGGGTTATACAGCTATT

CAATCTGCTGCTTACTGGGCTCGTGAAAACGATATGCTTTTACACTTACACCGTGCTGGTAACTCTACAT

ATGCACGTCAAAAAAACCATGGTATTAACTTCCGTGTAATTTGTAAATGGATGCGTATGTCTGGTGTAGA

TCATATCCACGCTGGAACAGTTGTAGGTAAATTAGAAGGTGATCCTTTAATGATTAAAGGTTTCTACGAT

ACTTTACGTTTAACTCATTTAGAAGTTAATTTACCATACGGTATTTTCTTCGAAATGCCTTGGGCTAGTT

TACGTCGTTGTATGCCAGTAGCATCTGGTGGTATTCACTGTGGTCAAATGCACCAATTAATTCACTACTT

AGGTGATGACGTAGTATTACAATTCGGTGGTGGTACAATTGGTCACCCTGATGGTATCCAAGCCGGTGCT

ACAGCTAACCGTGTTGCTTTAGAAGCAATGGTATTAGCTCGTAACGAAGGTGCTGATTTCTTCAGTAACG

AAGTTGGTCCTCAAATCTTACGTAATGCTGCTAAAACATGTGGTCCATTACAAACTGCATTAGATTTATG

GAAAGATATTAGTTTTAACTACACATCTACAGATACAGCTGATTTCGCTGTAACACCAACTGCAAACGTA

TAA

QUESTION 1

Which of the following substances is most acidic?

2 points   

QUESTION 2

A buffer is a substance that converts:

For this case study, you ideally will need to recruit a healthy adult competitive athlete. This person can be a recreational sports athlete, college athlete, or other type of active athlete. Alternatively, you can even use yourself. Note that this is just an academic exercise, so the person you are working with does not need to follow the program.

Go through Steps 1 to 8 from Unit 17, provided below, and develop nutritional guidepnes for your subject, dependent on the season that he/she is in. Then provide a discussion as to why you made your recommendations.

Show all calculations that may apply, using the methods in the course textbook related to the Steps. Make note of the person’s age, gender, sport, and athletic season.

Step 1: Determine body composition.

Step 2: Determine daily caloric expenditure range for training days and non-training days and for competition days.

Step 3: Determine the bioenergetics the sport primarily demands for peak athletic performance; Athlete- Type; Anaerobic - Immediate Energy System; Anaerobic Glycolytic; Anaerobic Glycolytic - Oxidative Glycolytic; and Oxidative. Some examples of sports are included below.

Step 4: Determine daily protein intake estimate and the foods and supplements to achieve it. Remember from your lessons that protein requirements can differ among different Athlete-Types and among individual athletes. This gives a scientific reason for making protein intake a priority for sports nutrition programs, in addition to other factors.

Step 5: Determine daily carbohydrate estimate and the foods and supplements to achieve it. Remember to plan for carbohydrate beverage intake before, during, and after practice and for sport events as appropriate. Modulate carbohydrate type and amount with meals and snacks to meet specific nutrition goals.

Step 6: Determine fat (essential fatty acids) intake estimate and plan, and select foods and cooking methods to achieve it. Keeping fat intake under 30 percent of total daily calories will be an ongoing skill to master. For certain sports, maintaining low fat intake during the season—between 15 and 20 percent of total daily calories—can be challenging and requires extra effort to make sure athletes are ingesting adequate amounts of the essential fatty acids: pnoleic and alpha-pnolenic acids. Add healthy sources of essential fatty acids in addition to EPA and DHA as required for health.

Step 7: Maintain proper fluid intake estimate to meet daily requirements, as determined by amount of physical activity, environmental factors, and specific athletic training, performance, and health needs.

Step 8: Determine the needs for using special sports nutrition and dietary supplement products.

1. You are studying 2 genes in Drosophila Melanogaster (fruit flies), Gene A and Gene B. Gene A and Gene B are located on different chromosomes and therefore will undergo independent assortment. Both genes have two different alleles, a dominant allele and a recessive allele. For example: for Gene A there is a dominant allele A and a recessive allele a. Gene A determines body color and gene B determines eye color. In terms of body color, some of your flies are purple and some of your flies are yellow. Purple is dominant to yellow. Gene B determines eye color, some of your flies have red eyes and some of your flies have brown eyes. Red is dominant to brown.

   You cross two individuals with the following genotypes: AABB X aabb. All of the offspring of this initial cross have the genotype AaBb. Next, you take two of the offspring from the initial cross and cross them. So, you just did the following cross AaBb X AaBb.

   What fraction of the offspring from the cross AaBb X AaBb will have yellow bodies?

   		3/16
   		9/16
   		1/4
   		3/4
   		none of the above

2. You are studying gene A and gene C in Drosophila Melanogaster (fruit flies). Gene A and Gene C are located on the same chromosome, which is an autosome, and crossing over never occurs between these two genes. Both genes have two different alleles, a dominant allele and a recessive allele. Again: for Gene A there is a dominant allele A and a recessive allele a. Gene A determines body color and gene C determines wing type. In terms of body color, some of your flies are purple and some of your flies are yellow. Purple is dominant to yellow. Gene C determines wing type, some of your flies have long wings and some of your flies have short wings. Long is dominant to short.

   You cross two individuals with the following genotypes: AAcc X aaCC. All of the offspring of this initial cross have the genotype AaCc. Next, you take two of the offspring from the initial cross and cross them. So, you just did the following cross AaCc X AaCc.

   In the last cross, AaCc X AaCc, what fraction of the offspring will have yellow bodies and long wings?

   		3/16
   		9/16
   		1/4
   		3/4
   		none of the above

3. You are studying a gene in humans that is located in the mitochondrial DNA.   A mutant form of this gene causes a disease we will call disease D. If a mother with disease D and a father who does not have disease D have 4 children, how many of their children would you predict have the disease?

   		0%
   		25%
   		50%
   		75%
   		100%

4. Researchers on Planet X have discovered a variety of seaweed. Some specimens glow in the dark, while others are completely colorless. Biochemists later find that two distinct gene products are needed to form the bioluminescent protein that makes some specimens glow. The glowing protein is formed according to the following scheme:

   Gene B codes for Enzyme B and their are two forms of this gene, a dominant allele B and a recessive allele b. The dominant allele codes for a functional Enzyme B, while the recessive allele codes for a nonfunctional Enzyme B.  Gene R codes for Enzyme R and their are two forms of this gene, a dominant allele R and a recessive allele r. The dominant allele codes for a functional Enzyme R, while the recessive allele codes for a nonfunctional Enzyme R. For both genes, having only one dominant allele is sufficient to produce functional enzyme.

   Given the information above, which of the following types of seaweed would glow? Make sure to read all of the choices.

   		BBrr
   		BBRR
   		BbRr
   		bbRR
   		bbRR and BBrr
   		BBRR and BbRr

5. You discover that gene P, gene I and gene R are on the same chromosome in Drosophila Melanogaster. When you do genetic crosses following the inheritance of gene P and gene R you get 1000 offspring and 300 of them are recombinants. When you do genetic crosses following the inheritance of gene P and I you get 1000 offspring and 100 of them are recombinants. When you do genetic crosses following the inheritance of gene R and I you get 1000 offspring and 200 of them are recombinants. Which two genes are the closest together?

   		P and R
   		R and I
   		P and I

Adenosine triphosphate

What are the 3 parts of an ATP molecule?

List two examples of how energy (ATP) might be put to use in a cell.

What is the function of NAD+ and FAD molecules?

Table Organize your knowledge

What is Chemiosmosis?

Where does it occur?

What are cytochromes?

What is ATP synthase?

What does it do?

For every glucose molecule burned, the cell needs _______ oxygen molecules, and produces _____molecules of Carbon Dioxide and ______ molecules of water. The maximum yield for aerobic respiration is _____ATP.

1. The endomembrane system is a collection of cell structures that work together. Each of the following are part of the endomembrane system: cell membrane, nucleus, ribosomes, endoplasmic reticulum, and golgi bodies.  

   • Explain how each of these cell structures are related to each other in function. In other words, briefly describe the central dogma of Biology. (Hint: your answer should be all about proteins!!)

2. Briefly describe the overall process of cellular respiration. Please DO NOT discuss specific stages of the process (ie glycolysis, pyruvate oxidation, Krebs cycle and ETC).

   • Where in the cell does cellular respiration take place?  

   • What are the reactants? What are the products?  

   • What is the purpose of the reaction?

A plant is placed in a sealed box with sufficient air, water and sunlight for several months. A chemical is added to the chamber that immediately adds electrons to all the oxygen in the chamber. Assume plants cannot perform fermentation. Also remember that gas diffuses freely across membranes and cell walls.

Which of the following is most likely if the plant is left in the chamber

Hexokinase catalyzes the first step of glycolysis, in which glucose is phosphorylated to form glucose-6-phosphate. Which of the following statements are accurate? Choose all that apply.

Hexokinase is found in the mitochondrial membrane.

Hexokinase consists of two domains, or lobes, that come together when glucose and the MgATP2� complex are bound.

Most kinases require the presence of a monovalent metal ion cofactor to prevent ATP hydrolysis.

The conformational shift that occurs when glucose, but not water, enters the active site prevents water from hydrolyzing ATP.

Hexokinase transfers the terminal phosphate of ATP to carbon 3 of glucose.

Hexokinase is a type of transferase that catalyzes the transfer of a phosphoryl group from ATP to a hexose.

Glucose Catabolism

1) Aerobic cellular respiration

• Glycolysis, Citric Acid cycle, Electron Transport Chain etc.

2) Anaerobic Respiration

3) Fermentation

Name the three major pathways for glucose catabolism (on the top ^) and briefly describe them (names of major step, inputs, outputs). For inputs and outputs, consider both carbon-based molecules and energy-containing molecules.  

For each pathway, discuss:

• An example of a final electron acceptors for each pathway

• The relative electronegativity of the final electron acceptor (comparing the 3 pathways)

• Relative amount of ATP made  

• Whether the pathway is complete or incomplete oxidation

• Whether the pathway is aerobic or anaerobic

Thank you in advance :)