Amino acids are classified as essential or nonessential. What does this mean and is the classification the same for all organisms?
In: Chemistry
polypeptide construction complete the following paragraph to describe how polypeptides are constructed from amino acids
In: Biology
Biefly describe the roles of three amino acids, Asp, His, and Ser in the Chymotrypsin-catalyzed reaction.
In: Chemistry
Discuss the different ways in which microorganisms degrade and
utilize lipids,
carbohydrates, protein and amino acids.
In: Biology
Weak interactions among amino acids that stabilize the tertiary structure of the protein include (list five):
In: Biology
If peptidases digest proteins into amino acids, why don’t they auto-digest the cells where they are synthesized?
In: Biology
Explain how amino acids can be used a source of energy, and outline how ammonia is detoxified.
In: Biology
The Patient:
Mathew Miller is a 7-day-old infant that is rushed to the emergency room by his parents Emma and Jacob Miller, Mennonites from Lancaster County, PA. Emma’s pregnancy and delivery with Mathew was normal but he started having trouble nursing and now has completely stopped feeding. By the time they reach the emergency room Mathew’s limbs were rigid and he had had a seizure.
The initial examination showed no infection and his x-rays were normal. The family history collected by the Doctor revealed that Emma and Jacob had had a previous son, Samuel that died at 9 days-of-age. There also is a history of unexplained childhood mortality on both sides of the family; Emma’s mother had two sisters who died in the first year of their lives and Jacob’s father had a sister who died at 7 months of age. Emma also points out to the Doctor that Mathew’s diaper has a funny smell to it. Blood and urine samples were taken for testing and skin biopsies from Mathew, Emma, and Jacob were taken and tested for enzyme activity. The tests results showed that:
Question 1:
What is the most likely diagnosis for Mathew?
A. Argininemia
B. Diabetes mellitus
C. Maple syrup urine disease
D. Phenylketonuria
In: Anatomy and Physiology
Below are the DNA sequences that encode the first eight amino acids for four alleles of the Adh protein in Drosophila melanogaster. Nucleotides that differ from the first sequence are shown by a lowercase letter.
ATGTCTCTCACCAACAAGAACGTC
ATGgCTCTCACCAACAAGAACGTC
ATGTCgCTCACCAACAAGAACGTC
ATGTCTtTgACCAACAAGAACGTC
a. What are the first eight amino acids for each of these four DNA sequences?
b. For each of the four polymorphic sites, indicate whether the site represents a synonymous or nonsynonymous polymorphism.
c. Synonymous polymorphisms tend to be more common than nonsynonymous ones. Why might that be?
In: Biology
In: Chemistry