Questions
Amino acids are classified as essential or nonessential. What does this mean and is the classification...

Amino acids are classified as essential or nonessential. What does this mean and is the classification the same for all organisms?​

In: Chemistry

polypeptide construction complete the following paragraph to describe how polypeptides are constructed from amino acids

polypeptide construction complete the following paragraph to describe how polypeptides are constructed from amino acids

In: Biology

Biefly describe the roles of three amino acids, Asp, His, and Ser in the Chymotrypsin-catalyzed reaction.

Biefly describe the roles of three amino acids, Asp, His, and Ser in the Chymotrypsin-catalyzed reaction.

In: Chemistry

Discuss the different ways in which microorganisms degrade and utilize lipids, carbohydrates, protein and amino acids.

Discuss the different ways in which microorganisms degrade and utilize lipids,
carbohydrates, protein and amino acids.

In: Biology

Weak interactions among amino acids that stabilize the tertiary structure of the protein include (list five):

Weak interactions among amino acids that stabilize the tertiary structure of the protein include (list five):

In: Biology

If peptidases digest proteins into amino acids, why don’t they auto-digest the cells where they are...

If peptidases digest proteins into amino acids, why don’t they auto-digest the cells where they are synthesized?

In: Biology

Explain how amino acids can be used a source of energy, and outline how ammonia is...

Explain how amino acids can be used a source of energy, and outline how ammonia is detoxified.

In: Biology

The Patient: Mathew Miller is a 7-day-old infant that is rushed to the emergency room by...

The Patient:

Mathew Miller is a 7-day-old infant that is rushed to the emergency room by his parents Emma and Jacob Miller, Mennonites from Lancaster County, PA. Emma’s pregnancy and delivery with Mathew was normal but he started having trouble nursing and now has completely stopped feeding. By the time they reach the emergency room Mathew’s limbs were rigid and he had had a seizure.

The initial examination showed no infection and his x-rays were normal. The family history collected by the Doctor revealed that Emma and Jacob had had a previous son, Samuel that died at 9 days-of-age. There also is a history of unexplained childhood mortality on both sides of the family; Emma’s mother had two sisters who died in the first year of their lives and Jacob’s father had a sister who died at 7 months of age. Emma also points out to the Doctor that Mathew’s diaper has a funny smell to it. Blood and urine samples were taken for testing and skin biopsies from Mathew, Emma, and Jacob were taken and tested for enzyme activity. The tests results showed that:

  • Mathew’s urine had elevated levels of the branched chain amino acids and their α-keto acid derivatives (which caused the sweet smell in his diapers)
  • Both Emma and Jacob’s skin biopsies had nearly normal levels of branched chain amino acid metabolism/enzyme activity
  • Mathew’s enzyme activity was less than 2% of normal

Question 1:

What is the most likely diagnosis for Mathew?

A.         Argininemia

B.         Diabetes mellitus

C.         Maple syrup urine disease

D.         Phenylketonuria

In: Anatomy and Physiology

Below are the DNA sequences that encode the first eight amino acids for four alleles of...

Below are the DNA sequences that encode the first eight amino acids for four alleles of the Adh protein in Drosophila melanogaster. Nucleotides that differ from the first sequence are shown by a lowercase letter.

ATGTCTCTCACCAACAAGAACGTC

ATGgCTCTCACCAACAAGAACGTC

ATGTCgCTCACCAACAAGAACGTC

ATGTCTtTgACCAACAAGAACGTC

a. What are the first eight amino acids for each of these four DNA sequences?

b. For each of the four polymorphic sites, indicate whether the site represents a synonymous or nonsynonymous polymorphism.

c. Synonymous polymorphisms tend to be more common than nonsynonymous ones. Why might that be?

In: Biology

1) Estimate the isoelectric point (pI) for the dipeptide Ser-Ile. Round the answer to one decimal...

1) Estimate the isoelectric point (pI) for the dipeptide Ser-Ile.

Round the answer to one decimal place.

2) Estimate the isoelectric point (pI) for the tripeptide Gly-Lys-Val.

Round the answer to one decimal place.

3)A mixture of Cys, Glu, Tyr, Lys and Ser was applied to a cation exchange column at pH 6.

Which of these amino acids eluted from the column first?   
Which of these amino acids eluted from the column last?   
Tyr Glu Lys Ser Cys

In: Chemistry