4. What is the difference between the null and alternative hypotheses? What does alpha

      represent? (4 pts)

The proportion of professional baseball players who take steroids has been assumed to be twenty percent by the team owner council. The Commissioner of Baseball has instituted a new campaign to reduce the proportion of players who take steroids. The Commissioner would now like to test whether their campaign has worked. (α = 0.05)

      State the null and alternative hypotheses that the Commissioner would test. Use

      symbols in the hypotheses. State alpha and define the parameter. (7 pts)

Ho: p = 0.2 (.)       

      Ha: p < 0.2 (.)                                

Time Magazine states that the nationwide drop out rate for high school seniors is ten percent. You conduct a test to see if the drop out rate for high school seniors is actually more than ten percent. ( α = 0.01)

     State the null and alternative hypotheses for this test. Use symbols in the hypotheses.

     State alpha and define the parameter. (7 pts)

The Maryland Department of Health claims that the proportion of heroin users in Maryland that have been infected by HIV is four percent. Suppose a researcher wants to show that this claim is not true. ( α = 0.1)

     State the null and alternative hypotheses to dispute the Maryland Department of

     Health’s claim. Use symbols in the hypotheses. State alpha and define the parameter.

    (7 pts)

Ho:        

      Ha:

Natasha was certain she was looking younger despite her 58 years on this Earth. Every day in the mirror her lines seemed to disappear. She had searched so long for something to slow the process of aging; her marriage depended on it! Vladimir would never stay with her if he saw the wrinkles she did! Even her precious parrot, Bruno, had noticed and shied away from her! She could never live without him so she tried it all: mercury creams, Botox, weight pills from the ancient woman in the south side market of Moscow, Switzerland’s best cell therapy, and one pint of honey and another of yogurt every day!

But a week or two after her “youth” came back she wasn’t feeling nearly so good…. Finally she went to the hospital because her fever was so high (102.8). She also had a non-stop horrible cough, muscle aches, vomiting, diarrhea, and a terrible headache. As the attendant physician at the hospital you try to narrow it down based on the patient profile, potential exposures and symptoms.

What are the top five suspects for Natasha’s infectious disease? Justify your choices. (10 points)

You send off for some laboratory tests right away and find the information below. Explain these results. Does this change your diagnosis? If so how? (6 points)

Leukocytes – 6,000,000,000/L

Platelets – 700,000/ L

RBC – 450,000,000/L

Hb – 14g/dL

HCT% - 49

Bilirubin – 6 mg/dL

Creatinine – 0.97 mg/dL

Natasha’s cough got worse and worse and the clock seemed to be ticking. The results of the molecular and immunological panel are below. Has your reasoning been confirmed? Interpret them and describe how they work. (12 points)

Western immunoblotting (first lane ladder, second Natasha’s blood, third positive control, fourth negative control)

LPS - 240 KDa

83149 antigen - 208 KDa

FlaA - 99 KDa

rRT-PCR

What is this organism doing in Natasha’s body to cause disease? (pathogenesis, virulence factors, detail) (15 points)

How did Natasha’s innate immune system try to protect her from the infection? (make sure it is specific for this type of attack) (10 points)

Please describe the acquired immune reaction that occurred in response to this infection. (make sure it is specific for this type of attack) (20 points)

What treatment would you prescribe after confirming your original diagnosis? How does each part of that treatment work? (6 points)

You sent off a sample for sequencing in order to aid in prescribing the proper treatment and got the following sequence back:

TGGATTATGCGATGTCGGTCATTTTGGACCGGGCTTTGCGCATATCGCAGACGGTTTAAAGCCCGTCCAGCGTCGAATCGTGTACGCCATGTCAGAATTGGGTTTAAAATCAACCGCTAAGTATAAGAAATCAGCGCGGACGGTAGGCGACGTTTTGGGTAAATTCCATCCGCACGGAGACACCGCCTGTTACGAGGCCATGGTATTGATGGCCCAACCTTTTTCATTTCGCTATCCCTTTGTCGATGGGCAAGGCAATTGGGGGAGCGCGGATGATCCC AAATCCTTTGCCGCCATGCGTTATACGGAAGCACGTCTG

Describe the complete process, step by step, that this protein plays a role in. (6 points)

Use an online tool to transcribe and translate the sequence and paste below. Describe how that would be done inside the cell of the pathogen in detail. (10 points)

E.coli has a glutamine at position 87 in this protein. Our pathogen has a glycine. Speculate on how this affects the organism and it’s ability to cause/maintain/spread disease in humans. Give molecular detail. (5 points)

How did Reagan’s policies reinforce the views and stereotypes that many white American had about social programs and the welfare state? What did the Reagan administration do to promote those stereotypes and beliefs? What stopped Democrats from being able to refute these stereotypes? What beliefs and stereotypes from this era still exist today?

We are evaluating a project that costs $896,000, has eight year life, and has no salvage value. Assume that depreciation is straight-line to zero over the life of the project. Sales are projected at 100,000 units per year. Price per unit is $38, variable cost per unit is $25, and fixed costs are $900,000 per year. The tax rate is 35%, and we require a 15% return on this project.

no excel, please :)

a- Calculate the accounting break-even point. What is the degree of operating leverage at the accounting break-even point? (77,847 units; 9.04)

b- Calculate the base-case cash flow and NPV. What is the sensitivity of NPV to changes in the sales figure? Explain what your answer tells you about a 500-unit decrease in projected sales.(Base case: $299,200; $446,606.60; After 500 unit decline: $294.975; $427,647.66)

c- What is the sensitivity of OCF to changes in the variable cost figure? Explain what your answer tells you about a $1 decrease in estimated variable costs. ($364,200; $65,000)

Use medication Active Learning Template describing in detail of Levothyroxine. Complete only the following sections:

 Medication- Medication Type  Category Class- Drug class  Expected Pharmacological Action  Therapeutic Uses  Complications  Medication Administration  Contraindications  Nursing Interventions  Interactions  Evaluation of Medication Effectiveness  Client Education b. Select a disease process that the selected

Show all of your work.

Assets                                                             Liabilities and Owner’s Equity                  

Prepare a financial analysis of this company (using ratios and your rationale) and comment on its status and performance in the space below. Use another page if you need more room. Explain what the ratios depict about the financial status of the company.

As our module reading highlights, applying test-taking skills involves what students do before, during and after the test. It includes managing test anxiety, becoming familiar with types of test questions, and using tests as a learning tool.

Think about these components as you review your process in applying test-taking skills.

Share responses to the following questions or statements:

• Explain how one or two of these suggestions for managing test anxiety can help you manage stress in test-taking and in a situation you face outside school.
• In addition to better grades, describe at least one benefit you could experience by taking tests more effectively.
• Of the techniques that you gained from this chapter, choose one that you will use on your next test. Cite it and outline exactly how you intend to apply the technique.

unit 6 DB food

The purchasing function is responsible for identifying the operational needs of the organization, negotiating, determining product specifications, and working with and choosing vendors. Managers are charged with making the appropriate buying decisions in an ethical and professional manner.

Topic: Purchasing and Technology

You read about blockchain ledger technology. Now do some additional research out on the Internet and share your URL with the rest of the class regarding either videos or viable information regarding blockchain technology.

Make sure to title each response as Part A or Part B.

Part A: Technology

• Discuss how you think this technology will change food and beverage purchasing. Explain your response.
• Discuss how POS systems are used in eating establishments. When does it make sense to use a POS system? What advantages are there for management in using a POS system?

Concentration of NaOH solution= 0.02803 M

Concentration of Crystal Violet dye solution=0.001 M

Room Temperature =25 degree celcius

Absorbance from the device- spectrovis(spectrophotometer)

The data in the trials are the absorbance.

-Its not Organic chemistry. Its an experiment about the crystal violet dye. Mainly they want to know how we get the rate law using these numbers.  It's asking for the rate law through these 2 trails and its asking to use some numbers to show how its solved . I also provided the procedure of the experiment.

1. Make sure the SpectroVis is plugged in to the LabQuest and the Labquest is plugged into a power outlet. 2. Turn on the Vernier by pressing the power button on the top 3. If it ask to Auto Recover, press no. 4. Tap Mode at the top right 5. Change the mode from Full Spectrum to Time Based. 6. Change the Interval to 30 seconds per sample 7. Make the Duration 450 seconds. 8. Tap OK 9. Tap Red USB: Abs 10. Tap Change Wavelength to 540 nm 11. Press Play in the bottom left, and allow Warm up for 90 seconds 12. Place Blank cuvette (NaOH) in SpectroVis. Ensure clear side is facing the arrow 13. Tap Finish Calibration 14. Add Crystal violet dye and immediately replace cuvette in SpectroVis and press ok. 15. Allow running for 450 seconds. 16. Press the file cabinet to ready a second trial 17. Repeat steps 11 and 12. 18. Get a fresh aliquot of NaOH of the second concentration. 19. Do two more trials with a second concentration of NaOH.

Time

Time: Trial 1 Trial 2

0 0.335 0.435

90 0.279 0.363

120 0.188 0.248

150 0.158 0.206

180 0.095 0.135

210 0.075 0.106

240 0.055 0.083

270 0.037 0.063

300 0.023 0.046

330 0.013 0.030

360 0.000 0.018

390 -0.007 0.006

420 -0.014 -0.002

450 -0.020 -0.009

The following calculations must be handwritten in your notebook. – Conversion of %Transmittance to Absorbance ■ Only one handwritten sample is necessary ■ However, all of your %Transmittance values must be converted to Absorbance in your Data Table

–The steps you took to determine the order with respect to the Crystal Violet Dye (X in the example)

– The steps you took to determine the order with respect to the NaOH (Y in the example)

– The steps you took to determine k – The overall, Modified Rate Law ■ With your values for X, Y, and k inserted into the equation

– Solve the Rate Law ■ Insert in all values necessary Result

Answer in steps please and in detail in order for me to understand it. I will appreciate your help thank you.