Explain the following natural events in terms of the laws of physics that you have learned in this class. Include figures if necessary. Answer any two.

How does a bird fly?

If you keep boiled egg inside refrigerator, it becomes difficult to take the shell off. But if you keep it warm water for a minute or so it becomes very easy. Why?

Why inside swimming pool we feel very light weight?

Mention all the laws of physics applied in these processes.

Explain the following natural events in terms of the laws of physics that you have learned in this class. Include figures if necessary. Answer any two.

How does a bird fly?

If you keep boiled egg inside refrigerator, it becomes difficult to take the shell off. But if you keep it warm water for a minute or so it becomes very easy. Why?

Why inside swimming pool we feel very light weight?

Mention all the laws of physics applied in these processes.

1. Identify the errors in the Questionnaire and suggest the revised questions
2. Mention for each question the scale of measurement (Nominal, ordinal, interval, Ratio)

BUSINESS WORLD

"Business World", a fortnightly magazine, is published from Bombay. It is brought out by management of Anand Bazaar Patrika Limited, Calcutta. In accordance with the decision taken in the annual editorial workshop of Business World held in early May 1986, a questionnaire was printed in some issues of Business World to know what readers thought of this magazine. By undel1aking a survey of this type, the management hoped to ascertain the strengths and weaknesses of the magazine. This would enable it "to tailor Business World to readers' requirements".

Questionnaire

Name:        _________________________________________________________________________________________

Profession:______________________________________________ Designation:______________________

Age;.................................. City:..................................................................... ,........................ ..........

Income:_____________

1. Which of these business magazines do you read? (please tick)

2. My areas of interest are (Please tick. one or more)

3. Rank the following magazines on a I to 5 scale (5 for very good, I for poor) for the following a!tributes:

4. How much time do you spend in reading an issue of Business World?

--------------Hours

5. How much of Business World do you read? (Please tick one)

(I) The entire magazine

(2) More than half the magazine

(3) More than a quarter of the magazine

(4) Less than a quarter of the magazine

6. Which of these features in Business World do you usually find interesting and read? (Please tick one or more)

7. Which of these specialist pages in Business World do you read and find interesting? (Please look at the shoulder heads inside the magazine pages if you are not sure.)

8. In order to suit my requirements better, Business World should have

Fewer main features stores                                                        (               )

The same number of main feature stories                              (               )

At least one more main feature story                                      (               )

9. The lead features (cover and spotlight) should be

Shorter                                                                                           (               )

Same length                                                                                  (               )

Longer                                                                                           (               )

10. Business World's coverage of the following items (Please tick one column for each entry):

11. Do you buy your copy of Business World from the News-stands or are you a subscriber?

a) News-stands        b)Subscriber

I f (a), do you find it difficult to get a copy of Business World on the news-stands')

Yes ____                                                              No _______        

12. How soon after the magazine is published each fortnight do you receive your copy of Business World?

1 ~ 3 days                                                                                        3 - 6 days

6 - 12 days                                                                                        Longer than 12 days

13. Do you have any other suggestions to improve Business World

Based on the given example in the table given below, mention the contraindications and nursing implications to specific health assessment findings Health assessment findings Contraindications Eg: Edema Edema may be a sign of fluid overload. Therefore, IV Fluids are likely to be contra indicated. Nursing implications: -Monitor Fluid balance -Assess for skin integrity and implement strategies to prevent skin breakdown -Position client comfortably to assist with breathing and to prevent friction and shear -Administer diuretics and other medications as prescribed Health assessment findings Contraindications

34.1) Dyspnea or wheezing

34.2) Bleeding

34.3) Hypotension

34.4) Allergy to seafood

34.5) Past history of Mastectomy

34.6) Neutropenia

Based on the given example in the table given below, mention the contraindications and nursing implications to specific health assessment findings Health assessment findings Contraindications Eg: Edema Edema may be a sign of fluid overload. Therefore, IV Fluids are likely to be contra indicated. Nursing implications: -Monitor Fluid balance -Assess for skin integrity and implement strategies to prevent skin breakdown -Position client comfortably to assist with breathing and to prevent friction and shear -Administer diuretics and other medications as prescribed Health assessment findings Contraindications 34.1) Dyspnea or wheezing 34.2) Bleeding 34.3) Hypotension

Managerial Economics Question.

(Please solve both A and B, and mention which one is A and B, thank you for working so much hard for me, I appreciate it.)

1. Royersford Kinitting Mills Ltd. sells a line of women's knit underwear. The firm now sells about 20,000 pairs a year at an average price of $10 each. Fixed costs amount to $60,000, and total variable costs equal $120,000. The production department has estimated that a 10 percent increase in output would not affect fixed costs but would reduce average variable cost by 40 cents.

The marketing department advocates a price reduction of 5 percent to increase sales, total revenues, and profits. The arc elasticity of demand with respect to prices is estimated at -2.

A) Evaluate the impact of the proposal to cut prices on (i) total revenue, (ii) total cost, and (iii) total profits.

B) If average variable costs are assumed to remain constant over a 10 percent increase in output, evaluate the effects of the proposed price cut on total profits.

1. Directions: Identify the restriction sites for each of the examples given. Show the cuts, mention if they are sticky ends or blunt, 5’ overhangs or 3 ‘overhangs and the number of DNA fragments produced and the number of base pairs in each (count the top row).

            Remember: Analyze in the 5’à 3’ direction

1. HindII --- 5' GTC ↓GAC 3'

5' ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3'

3' TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5'

Number of pieces of DNA _______

2. EcoRI --- 5' G ↓AATTC 3'

5' ACG ACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3'

3' TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5'

Number of pieces of DNA _______

3. HaeIII --- 5' CC ↓ GG 3'

5' ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3'

3' TGCGGCCGGCATAATAGGCCTAGGCGGCGGCCGACAGGGCCTAGT 5'

Number of pieces of DNA _______

4. BamI --- 5' CCTAG ↓G 3'

5' ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3'

3' TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5'

Number of pieces of DNA _______

5. HindII --- 5' GTC ↓- GAC 3' and HaeIII --- 5' CC ↓ GG 3'

5' ACGGTCGACACGTATTATTAGTCGACTCCGCCGCCGCCGGTCATCA 3'

3' TGCCAGCTGTGCATAATAATCAGCTGAGGCGGCGGCGGCCAGTAGT 5'

Number of pieces of DNA _______

6.   HindII --- 5' GTC ↓ GAC 3', HaeIII --- 5' CC ↓ GG 3' and BamI --- 5' CCTAG ↓ G 3'

5' ACGCCGGACGTACCTAGGTTTAGTCGACTC CGCCG CCCCTAGGGTCATCA 3'

3' TGCGGCCTGCATGGATCCAAATCAGCTGAGGCGGCGGGGATCCCAGTAGT 5'

Number of pieces of DNA _______

In Case 15, GoPro’s Struggle for Survival in 2016, the following is mention:

As GoPro moved into 2015, it appeared to be the poster child for American entrepreneurial success, going from a humble beginning as a homemade camera tether and plastic case vendor in 2004, to an action camera vendor with $350,000 in sales in 2005 (its first full year of operation), to revenue of $1.6 billion in 2015. The company had gone public in June, 2014, and at its peak in October, 2014, GoPro stock traded at over $98.00. In 2014, GoPro was ranked #1 most popular brand on YouTube with more than 640 million views, and an average of 845 thousand views daily. In 2015, the average daily views were up to 1.01 million. Abruptly, in the third quarter of 2015, GoPro’s magic disappeared. Fourth quarter, 2015 revenue dropped by 31 percent from the prior year, and net income (loss) fell by 128 percent to a net loss of $34.5 million. By the end of December, 2015, the stock traded at less than $20.00. GoPro’s sales continued to slip in 2016. The newly introduced HERO4 camera performed poorly, and the company cut its price by half and reduced its product line to three cameras. The Karma camera drone, set for release in the first half of 2016, was inexplicably pushed back to winter, and there was no date for release of the HERO5 action camera. After the first quarter 2016 results were released, GoPro’s stock dropped below $9.00. According to Investor Place (28 March, 2016), GoPro had “essentially erased its once coveted title of Wall Street’s darling and is now loathed by Wall Street.”

What is your assessment of GoPro’s business model and competitive strategy? Does its approach to deliver customer value contribute to a sustainable competitive advantage?

One of the competitive strategies to consider is whether to be a “first-mover,” “first-follower,” or “slow-mover.” Which strategy do you believe Go-Pro has embraced? Is your chosen strategy the right course of action for Go-pro all of the time? Please explain

Quesiton 3

a.      1492 is a significant date in the history of humanity. Please mention several points in explaining the significance of this date to major changes that would follow.

b. What drove Europeans to explore the world? How did the slave trade affect the New World? How did it affect Africa?

c. How and why did a world market emerge? Explain how the geographical discoveries, Columbian Exchange, conquistadores, and the Atlantic Trade Triangle relate to each other.

You order a laptop (mention the type or the code) from an online shop. The delivery arrived on time but some of the components and extra tools are missing. Write an email to the company mentioning that the order arrived on time, complaining about the missing items. Ask how much longer you will have to wait and ask the company what action(s) it will take over this matter. You should write at least (200) words. You should consider the whole components of the email- greeting, opening, requests, closing, salutation. You do NOT need to write your own address. Begin your email as follows: Dear Sir/Madam

We mention that the differences between qualitative and quantitative analytics are not necessarily about differences in the analytics methods used as much as it is about the different stages of analysis. As we consider descriptive and predictive analytics techniques used to address business risks, how would you go about determining how these techniques might align with qualitative and quantitative methods used in addressing the initial stages of risk identification?