OUTLINE the differences in the envelope structures of Gram-positive and Gram-negative bacteria. You may use diagrams or a table.
Describe the behavior of chemotaxis in bacteria. Make sure to mention how the flagella contributes and how they can move toward good things and away from bad things.
DESCRIBE the Endosymbiotic Theory and OUTLINE the evidence to support
In: Biology
1- Definition and introduction of its layer
2- Explain the network functions
3- Explain the data transfer method in the network
4- Mention the protocols if there is and explain them
5- Network positives and negatives effect
for
physical layer
data link layer
network layer
transport layer
presentation layer
application layer
and the tcp/ip
In: Computer Science
Explain the following natural events in terms of the laws of physics that you have learned in this class. Include figures if necessary. Answer any two.
How does a bird fly?
If you keep boiled egg inside refrigerator, it becomes difficult to take the shell off. But if you keep it warm water for a minute or so it becomes very easy. Why?
Why inside swimming pool we feel very light weight?
Mention all the laws of physics applied in these processes.
Explain the following natural events in terms of the laws of physics that you have learned in this class. Include figures if necessary. Answer any two.
How does a bird fly?
If you keep boiled egg inside refrigerator, it becomes difficult to take the shell off. But if you keep it warm water for a minute or so it becomes very easy. Why?
Why inside swimming pool we feel very light weight?
Mention all the laws of physics applied in these processes.
In: Physics
1. Identify the errors in the Questionnaire and suggest the
revised questions
2. Mention for each question the scale of measurement (Nominal,
ordinal, interval, Ratio)
BUSINESS WORLD
"Business World", a fortnightly magazine, is published from Bombay. It is brought out by management of Anand Bazaar Patrika Limited, Calcutta. In accordance with the decision taken in the annual editorial workshop of Business World held in early May 1986, a questionnaire was printed in some issues of Business World to know what readers thought of this magazine. By undel1aking a survey of this type, the management hoped to ascertain the strengths and weaknesses of the magazine. This would enable it "to tailor Business World to readers' requirements".
Questionnaire
Name: _________________________________________________________________________________________
Profession:______________________________________________ Designation:______________________
Age;.................................. City:..................................................................... ,........................ ..........
Income:_____________
1. Which of these business magazines do you read? (please tick)
|
Regularly |
Occasionally |
Irregulgularily |
|
|
Economic Times |
|||
|
Financial Express |
|||
|
Business Standard |
|||
|
Business World |
|||
|
Business India |
|||
|
Fortune India |
|||
|
Update |
|||
|
Others (specify) |
2. My areas of interest are (Please tick. one or more)
|
Corporate and business affairs |
( |
) |
|
Economic policy and development |
( |
) |
|
Political affairs |
( |
) |
|
People and lifestyles |
( |
) |
|
Art literature |
( |
) |
|
Investments |
( |
) |
3. Rank the following magazines on a I to 5 scale (5 for very good, I for poor) for the following a!tributes:
|
Business World |
Business India |
Fortune India |
Update |
|
|
1. Timeliness of information |
||||
|
2. Depth of information |
||||
|
3. Range of information |
||||
|
4. Depth of analysis |
||||
|
5. Language and style of presentation |
||||
|
6. Quality of printing and visuals. |
4. How much time do you spend in reading an issue of Business World?
--------------Hours
5. How much of Business World do you read? (Please tick one)
(I) The entire magazine
(2) More than half the magazine
(3) More than a quarter of the magazine
(4) Less than a quarter of the magazine
6. Which of these features in Business World do you usually find interesting and read? (Please tick one or more)
|
(I) Cover Feature |
( |
) |
(7) Editorial |
( |
) |
|
(2) Spotlight |
( |
) |
(8) Company News & Events |
( |
) |
|
(3) Business News |
( |
) |
(9) International Briefs |
( |
) |
|
(4) In the News |
( |
) |
(10) Entrepreneurs |
( |
) |
|
(5) International News |
( |
) |
(11) Leisure |
( |
) |
|
(6) Off Stage |
( |
) |
7. Which of these specialist pages in Business World do you read and find interesting? (Please look at the shoulder heads inside the magazine pages if you are not sure.)
|
(a) |
Political comment |
(g) |
Careers and professionals |
|
(b) |
Banking and finance |
(h) |
Media trends |
|
(c) |
Econom ic comment |
(i) |
Book serial |
|
(d) |
Taxation |
Ci) |
Business information |
|
(c) |
Management |
(k) |
Marketing |
|
(I) |
Computers |
(I) |
Investment |
8. In order to suit my requirements better, Business World should have
Fewer main features stores ( )
The same number of main feature stories ( )
At least one more main feature story ( )
9. The lead features (cover and spotlight) should be
Shorter ( )
Same length ( )
Longer ( )
10. Business World's coverage of the following items (Please tick one column for each entry):
|
Is adequate |
Needs to be reduced |
Needs to be expanded |
|
|
Technology |
|||
|
Marketing |
|||
|
Management |
|||
|
Corporate Finance |
|||
|
Investment/Stock Markets |
|||
|
Book Reviews |
|||
|
Economic Policy |
|||
|
Policy Analysis |
|||
|
Corporate Performance |
|||
|
Corporate Case Studies |
|||
|
Behaviour |
11. Do you buy your copy of Business World from the News-stands or are you a subscriber?
a) News-stands b)Subscriber
I f (a), do you find it difficult to get a copy of Business World on the news-stands')
Yes ____ No _______
12. How soon after the magazine is published each fortnight do you receive your copy of Business World?
1 ~ 3 days 3 - 6 days
6 - 12 days Longer than 12 days
13. Do you have any other suggestions to improve Business World
In: Statistics and Probability
Based on the given example in the table given below, mention the contraindications and nursing implications to specific health assessment findings Health assessment findings Contraindications Eg: Edema Edema may be a sign of fluid overload. Therefore, IV Fluids are likely to be contra indicated. Nursing implications: -Monitor Fluid balance -Assess for skin integrity and implement strategies to prevent skin breakdown -Position client comfortably to assist with breathing and to prevent friction and shear -Administer diuretics and other medications as prescribed Health assessment findings Contraindications
34.1) Dyspnea or wheezing
34.2) Bleeding
34.3) Hypotension
34.4) Allergy to seafood
34.5) Past history of Mastectomy
34.6) Neutropenia
In: Nursing
Based on the given example in the table given below, mention the contraindications and nursing implications to specific health assessment findings Health assessment findings Contraindications Eg: Edema Edema may be a sign of fluid overload. Therefore, IV Fluids are likely to be contra indicated. Nursing implications: -Monitor Fluid balance -Assess for skin integrity and implement strategies to prevent skin breakdown -Position client comfortably to assist with breathing and to prevent friction and shear -Administer diuretics and other medications as prescribed Health assessment findings Contraindications 34.1) Dyspnea or wheezing 34.2) Bleeding 34.3) Hypotension
In: Nursing
Managerial Economics Question.
(Please solve both A and B, and mention which one is A and B, thank you for working so much hard for me, I appreciate it.)
1. Royersford Kinitting Mills Ltd. sells a line of women's knit underwear. The firm now sells about 20,000 pairs a year at an average price of $10 each. Fixed costs amount to $60,000, and total variable costs equal $120,000. The production department has estimated that a 10 percent increase in output would not affect fixed costs but would reduce average variable cost by 40 cents.
The marketing department advocates a price reduction of 5 percent to increase sales, total revenues, and profits. The arc elasticity of demand with respect to prices is estimated at -2.
A) Evaluate the impact of the proposal to cut prices on (i) total revenue, (ii) total cost, and (iii) total profits.
B) If average variable costs are assumed to remain constant over a 10 percent increase in output, evaluate the effects of the proposed price cut on total profits.
In: Economics
Remember: Analyze in the 5’à 3’ direction
1. HindII --- 5' GTC ↓GAC 3'
5' ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3'
3' TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5'
Number of pieces of DNA _______
2. EcoRI --- 5' G ↓AATTC 3'
5' ACG ACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3'
3' TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5'
Number of pieces of DNA _______
3. HaeIII --- 5' CC ↓ GG 3'
5' ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3'
3' TGCGGCCGGCATAATAGGCCTAGGCGGCGGCCGACAGGGCCTAGT 5'
Number of pieces of DNA _______
4. BamI --- 5' CCTAG ↓G 3'
5' ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3'
3' TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5'
Number of pieces of DNA _______
5. HindII --- 5' GTC ↓- GAC 3' and HaeIII --- 5' CC ↓ GG 3'
5' ACGGTCGACACGTATTATTAGTCGACTCCGCCGCCGCCGGTCATCA 3'
3' TGCCAGCTGTGCATAATAATCAGCTGAGGCGGCGGCGGCCAGTAGT 5'
Number of pieces of DNA _______
6. HindII --- 5' GTC ↓ GAC 3', HaeIII --- 5' CC ↓ GG 3' and BamI --- 5' CCTAG ↓ G 3'
5' ACGCCGGACGTACCTAGGTTTAGTCGACTC CGCCG CCCCTAGGGTCATCA 3'
3' TGCGGCCTGCATGGATCCAAATCAGCTGAGGCGGCGGGGATCCCAGTAGT 5'
Number of pieces of DNA _______
In: Biology
In Case 15, GoPro’s Struggle for Survival in 2016, the following is mention:
As GoPro moved into 2015, it appeared to be the poster child for American entrepreneurial success, going from a humble beginning as a homemade camera tether and plastic case vendor in 2004, to an action camera vendor with $350,000 in sales in 2005 (its first full year of operation), to revenue of $1.6 billion in 2015. The company had gone public in June, 2014, and at its peak in October, 2014, GoPro stock traded at over $98.00. In 2014, GoPro was ranked #1 most popular brand on YouTube with more than 640 million views, and an average of 845 thousand views daily. In 2015, the average daily views were up to 1.01 million. Abruptly, in the third quarter of 2015, GoPro’s magic disappeared. Fourth quarter, 2015 revenue dropped by 31 percent from the prior year, and net income (loss) fell by 128 percent to a net loss of $34.5 million. By the end of December, 2015, the stock traded at less than $20.00. GoPro’s sales continued to slip in 2016. The newly introduced HERO4 camera performed poorly, and the company cut its price by half and reduced its product line to three cameras. The Karma camera drone, set for release in the first half of 2016, was inexplicably pushed back to winter, and there was no date for release of the HERO5 action camera. After the first quarter 2016 results were released, GoPro’s stock dropped below $9.00. According to Investor Place (28 March, 2016), GoPro had “essentially erased its once coveted title of Wall Street’s darling and is now loathed by Wall Street.”
What is your assessment of GoPro’s business model and competitive strategy? Does its approach to deliver customer value contribute to a sustainable competitive advantage?
One of the competitive strategies to consider is whether to be a “first-mover,” “first-follower,” or “slow-mover.” Which strategy do you believe Go-Pro has embraced? Is your chosen strategy the right course of action for Go-pro all of the time? Please explain
In: Operations Management
Quesiton 3
a. 1492 is a significant date in the history of humanity. Please mention several points in explaining the significance of this date to major changes that would follow.
b. What drove Europeans to explore the world? How did the slave trade affect the New World? How did it affect Africa?
c. How and why did a world market emerge? Explain how the geographical discoveries, Columbian Exchange, conquistadores, and the Atlantic Trade Triangle relate to each other.
In: Psychology