Questions
A closed and elevated vertical cylindrical tank with diameter 2.10 m contains water to a depth...

A closed and elevated vertical cylindrical tank with diameter 2.10 m contains water to a depth of 0.500 m . A worker accidently pokes a circular hole with diameter 0.0170 m in the bottom of the tank. As the water drains from the tank, compressed air above the water in the tank maintains a gauge pressure of 5.00×103 Pa at the surface of the water. Ignore any effects of viscosity.

A)Just after the hole is made, what is the speed of the water as it emerges from the hole? (v=____)

B)What is the ratio of this speed to the efflux speed if the top of the tank is open to the air? (v/vopen=________)

C)How much time does it take for all the water to drain from the tank? (t=_______)

D)What is the ratio of this time to the time it takes for the tank to drain if the top of the tank is open to the air? (t/topen=_______)

In: Physics

What is the final volume of each of the following diluted solutions? A.8.0 % (m/v) H2SO4...

What is the final volume of each of the following diluted solutions?

A.8.0 % (m/v) H2SO4 solution prepared from 6.00 mL of a solution that is 19.0 % H2SO4

Express your answer in liters using two significant figures.

B.1.4 M HCl solution prepared from 11 mL of a solution that is 2.0 M HCl

Express your answer in liters using two significant figures.

C.1.0 M NaOH solution prepared from 60.0 mL of a solution that is 10.0 M NaOH

Express your answer in liters using two significant figures.

D.3.0 % (m/v) CaCl2 solution prepared from 20 mL of a solution that is 12.00 % CaCl2

Express your answer in liters using two significant figures.

In: Chemistry

Consider Dataset A for answering the questions that follows below. a. Calculate the measures of central...

Consider Dataset A for answering the questions that follows below. a. Calculate the measures of central tendencies for Variable X and Variable Y. i. Mean ii. Median iii. Mode iv. Midrange v. What can you say about the skewness of X and Y variables? b. Calculate the measures of variations for Variable X and Variable Y. i. Range ii. Variance iii. Standard Deviation iv. Coefficient of Variation v. Which is more variable, X or Y? Why? c. Calculate the measures of position for Variable X. i. Z-score of the mean value of X ii. Percentile rank of the maximum value of X iii. Check for any outliers in variable X

variable X:6,7,8,8,8,9,9,9,11,11

variableY: -2.77,-0.23,-0.29,-0.05,0.33,0.43,0.51,0.63,0.85,1.12

In: Statistics and Probability

A parallel plate capacitor with plate separation d is connected to a battery. The capacitor is...

A parallel plate capacitor with plate separation d is connected to a battery. The capacitor is fully charged to Q Coulombs and a voltage of V. (C is the capacitance and U is the stored energy.) Answer the following questions regarding the capacitor charged by a battery. For each statement below, select True or False.

1. With the capacitor connected to the battery, inserting a dielectric with κ will increase C.
2. With the capacitor connected to the battery, decreasing d increases C.
3. After being disconnected from the battery, decreasing d increases U.
4. With the capacitor connected to the battery, decreasing d decreases Q.
5. With the capacitor connected to the battery, inserting a dielectric with κ will decrease U.
6. After being disconnected from the battery, inserting a dielectric with κ will decrease V.

In: Physics

Below is a segment of coding sequence from the overlapping Ink4A-Arflocus (top line) and protein sequence...

Below is a segment of coding sequence from the overlapping Ink4A-Arflocus (top line) and protein sequence from Ink4A(line 2, zero frame) and Arf(line 3, +2 frame).

caggtcatgatgatgggcagcgcccgagtggcggagctgctgctgctccacggcgcggag

Q  V  M M  M  G  S  A R  V  A  E  L L  L  L  H G  A  E

G  H  D D  G  Q R  P  S G  G  A A  A  A  P  R  R  G

-What bases could be used to maintain this Leucine codon in Ink4A but mutate the Proline codon in Arf?

- What amino acid codons could be introduced into Arf Proline codon without changing the Ink4A Leucine codon?

- What mutant amino acids may be substrates for phosphorylation?

In: Biology

The magnetic field in a plane monochromatic electromagnetic wave with wavelength λ = 684 nm, propagating...

The magnetic field in a plane monochromatic electromagnetic wave with wavelength λ = 684 nm, propagating in a vacuum in the z-direction is described by

B⃗ =(B1sin(kz−ωt))(i^+j^)B→=(B1sin⁡(kz−ωt))(i^+j^)

where B1 = 5.3 X 10-6 T, and i-hat and j-hat are the unit vectors in the +x and +y directions, respectively.

1)

What is k, the wavenumber of this wave?

m-1

2)

What is zmax, the distance along the positive z-axis to the position where the magnitude of the magnetic field is a maximum at t = 0?

nm

3)

What is Emax, the amplitude of the electric field oscillations?

V/m

4)

What is Ey, the y-component of the electric field at (x = 0, y-0, z = zmax) at t = 0?

V/m

In: Physics

A 4.0 µF capacitor and a 5.0 µF capacitor are connected in series across a 1.5...

A 4.0 µF capacitor and a 5.0 µF capacitor are connected in series across a 1.5 kV potential difference. The charged capacitors are then disconnected from the source and connected to each other with terminals of like sign together. Find the charge on each capacitor (in mC) and the voltage across each capacitor (in V). (Due to the nature of this problem, do not use rounded intermediate values in your calculations—including answers submitted in WebAssign.)

4.0 µF capacitor

charge 3.706mC Incorrect: Your answer is incorrect.

voltage 741.11 Correct: Your answer is correct.

V 5.0µF capacitor

charge 2.964mC Incorrect: Your answer is incorrect.

voltage 741.11 Correct: Your answer is correct.

MY ANSWERS ARE IN BOLD. CAN ANYONE EXPLAIN WHAT THE CORRECT ANSWER IS?

In: Physics

Two large, thin, metal plates of 0.5mx0.5m face each other. They are spaced 2cm apart and...

Two large, thin, metal plates of 0.5mx0.5m face each other. They are spaced 2cm apart and have equal but opposite charges on their inner surfaces.

a) if the magnitude E of the electric field between the plates is 700 N/C what is the magnitude of the charge on each plate?

b) Integrate E across the gap between the plates to find the potential difference V and hence the capacitance C.

c) Recalculate C using the parallel plate capacitator formula instead.

d) the energy density of the field between the plates?

e) the total energy of the field between the plates?

f) use C and V to calculate the energy stored in the capacitator to compare to the result of e

If a very detailed explanation could be given that'd be great because im super stuck!

In: Physics

A psychologist studying addiction tests whether cravings for cocaine and relapse are independent. The following table...

A psychologist studying addiction tests whether cravings for cocaine and relapse are independent. The following table lists the observed frequencies in the small sample of people who use drugs.

Obs. Freq. Relapse   
Yes No
Cravings Yes 21 10 31
No 7 18 25
   28 28 N = 56

(a) Conduct a chi-square test for independence at a 0.05 level of significance. (Round your answer to two decimal places.)
=  

Decide whether to retain or reject the null hypothesis.

Retain the null hypothesis.Reject the null hypothesis.   


(b) Compute effect size using ϕ and Cramer's V. Hint: Both should give the same estimate of effect size. (If necessary, round your intermediate steps to two or more decimal places. Round your answers to two decimal places.)

ϕ =
V =

In: Statistics and Probability

20#15 Given the following half-reactions and associated standard reduction potentials: AuBr−4(aq)+3e−→Au(s)+4Br−(aq) E∘red=−0.858V Eu3+(aq)+e−→Eu2+(aq) E∘red=−0.43V IO−(aq)+H2O(l)+2e−→I−(aq)+2OH−(aq) E∘red=+0.49V...

20#15

Given the following half-reactions and associated standard reduction potentials:
AuBr−4(aq)+3e−→Au(s)+4Br−(aq)
E∘red=−0.858V
Eu3+(aq)+e−→Eu2+(aq)
E∘red=−0.43V
IO−(aq)+H2O(l)+2e−→I−(aq)+2OH−(aq)
E∘red=+0.49V
Sn2+(aq)+2e−→Sn(s)
E∘red=−0.14V

a) Write the cell reaction for the combination of these half-cell reactions that leads to the largest positive cell emf.

b) Calculate the value of this emf.

E∘max = _____ V

c) Write the cell reaction for the combination of half-cell reactions that leads to the smallest positive cell emf.

d) Calculate the value of this emf.

E∘min = _____ V

In: Chemistry