Questions
Consider Dataset A for answering the questions that follows below. a. Calculate the measures of central...

Consider Dataset A for answering the questions that follows below. a. Calculate the measures of central tendencies for Variable X and Variable Y. i. Mean ii. Median iii. Mode iv. Midrange v. What can you say about the skewness of X and Y variables? b. Calculate the measures of variations for Variable X and Variable Y. i. Range ii. Variance iii. Standard Deviation iv. Coefficient of Variation v. Which is more variable, X or Y? Why? c. Calculate the measures of position for Variable X. i. Z-score of the mean value of X ii. Percentile rank of the maximum value of X iii. Check for any outliers in variable X

variable X:6,7,8,8,8,9,9,9,11,11

variableY: -2.77,-0.23,-0.29,-0.05,0.33,0.43,0.51,0.63,0.85,1.12

In: Statistics and Probability

A parallel plate capacitor with plate separation d is connected to a battery. The capacitor is...

A parallel plate capacitor with plate separation d is connected to a battery. The capacitor is fully charged to Q Coulombs and a voltage of V. (C is the capacitance and U is the stored energy.) Answer the following questions regarding the capacitor charged by a battery. For each statement below, select True or False.

1. With the capacitor connected to the battery, inserting a dielectric with κ will increase C.
2. With the capacitor connected to the battery, decreasing d increases C.
3. After being disconnected from the battery, decreasing d increases U.
4. With the capacitor connected to the battery, decreasing d decreases Q.
5. With the capacitor connected to the battery, inserting a dielectric with κ will decrease U.
6. After being disconnected from the battery, inserting a dielectric with κ will decrease V.

In: Physics

Below is a segment of coding sequence from the overlapping Ink4A-Arflocus (top line) and protein sequence...

Below is a segment of coding sequence from the overlapping Ink4A-Arflocus (top line) and protein sequence from Ink4A(line 2, zero frame) and Arf(line 3, +2 frame).

caggtcatgatgatgggcagcgcccgagtggcggagctgctgctgctccacggcgcggag

Q  V  M M  M  G  S  A R  V  A  E  L L  L  L  H G  A  E

G  H  D D  G  Q R  P  S G  G  A A  A  A  P  R  R  G

-What bases could be used to maintain this Leucine codon in Ink4A but mutate the Proline codon in Arf?

- What amino acid codons could be introduced into Arf Proline codon without changing the Ink4A Leucine codon?

- What mutant amino acids may be substrates for phosphorylation?

In: Biology

The magnetic field in a plane monochromatic electromagnetic wave with wavelength λ = 684 nm, propagating...

The magnetic field in a plane monochromatic electromagnetic wave with wavelength λ = 684 nm, propagating in a vacuum in the z-direction is described by

B⃗ =(B1sin(kz−ωt))(i^+j^)B→=(B1sin⁡(kz−ωt))(i^+j^)

where B1 = 5.3 X 10-6 T, and i-hat and j-hat are the unit vectors in the +x and +y directions, respectively.

1)

What is k, the wavenumber of this wave?

m-1

2)

What is zmax, the distance along the positive z-axis to the position where the magnitude of the magnetic field is a maximum at t = 0?

nm

3)

What is Emax, the amplitude of the electric field oscillations?

V/m

4)

What is Ey, the y-component of the electric field at (x = 0, y-0, z = zmax) at t = 0?

V/m

In: Physics

A 4.0 µF capacitor and a 5.0 µF capacitor are connected in series across a 1.5...

A 4.0 µF capacitor and a 5.0 µF capacitor are connected in series across a 1.5 kV potential difference. The charged capacitors are then disconnected from the source and connected to each other with terminals of like sign together. Find the charge on each capacitor (in mC) and the voltage across each capacitor (in V). (Due to the nature of this problem, do not use rounded intermediate values in your calculations—including answers submitted in WebAssign.)

4.0 µF capacitor

charge 3.706mC Incorrect: Your answer is incorrect.

voltage 741.11 Correct: Your answer is correct.

V 5.0µF capacitor

charge 2.964mC Incorrect: Your answer is incorrect.

voltage 741.11 Correct: Your answer is correct.

MY ANSWERS ARE IN BOLD. CAN ANYONE EXPLAIN WHAT THE CORRECT ANSWER IS?

In: Physics

Two large, thin, metal plates of 0.5mx0.5m face each other. They are spaced 2cm apart and...

Two large, thin, metal plates of 0.5mx0.5m face each other. They are spaced 2cm apart and have equal but opposite charges on their inner surfaces.

a) if the magnitude E of the electric field between the plates is 700 N/C what is the magnitude of the charge on each plate?

b) Integrate E across the gap between the plates to find the potential difference V and hence the capacitance C.

c) Recalculate C using the parallel plate capacitator formula instead.

d) the energy density of the field between the plates?

e) the total energy of the field between the plates?

f) use C and V to calculate the energy stored in the capacitator to compare to the result of e

If a very detailed explanation could be given that'd be great because im super stuck!

In: Physics

A psychologist studying addiction tests whether cravings for cocaine and relapse are independent. The following table...

A psychologist studying addiction tests whether cravings for cocaine and relapse are independent. The following table lists the observed frequencies in the small sample of people who use drugs.

Obs. Freq. Relapse   
Yes No
Cravings Yes 21 10 31
No 7 18 25
   28 28 N = 56

(a) Conduct a chi-square test for independence at a 0.05 level of significance. (Round your answer to two decimal places.)
=  

Decide whether to retain or reject the null hypothesis.

Retain the null hypothesis.Reject the null hypothesis.   


(b) Compute effect size using ϕ and Cramer's V. Hint: Both should give the same estimate of effect size. (If necessary, round your intermediate steps to two or more decimal places. Round your answers to two decimal places.)

ϕ =
V =

In: Statistics and Probability

20#15 Given the following half-reactions and associated standard reduction potentials: AuBr−4(aq)+3e−→Au(s)+4Br−(aq) E∘red=−0.858V Eu3+(aq)+e−→Eu2+(aq) E∘red=−0.43V IO−(aq)+H2O(l)+2e−→I−(aq)+2OH−(aq) E∘red=+0.49V...

20#15

Given the following half-reactions and associated standard reduction potentials:
AuBr−4(aq)+3e−→Au(s)+4Br−(aq)
E∘red=−0.858V
Eu3+(aq)+e−→Eu2+(aq)
E∘red=−0.43V
IO−(aq)+H2O(l)+2e−→I−(aq)+2OH−(aq)
E∘red=+0.49V
Sn2+(aq)+2e−→Sn(s)
E∘red=−0.14V

a) Write the cell reaction for the combination of these half-cell reactions that leads to the largest positive cell emf.

b) Calculate the value of this emf.

E∘max = _____ V

c) Write the cell reaction for the combination of half-cell reactions that leads to the smallest positive cell emf.

d) Calculate the value of this emf.

E∘min = _____ V

In: Chemistry

A bullet with a mass m b = 11.5 g is fired into a block of...

A bullet with a mass m b = 11.5 g is fired into a block of wood at velocity v b = 265 m/s. The block is attached to a spring that has a spring constant k of 205 N/m. The block and bullet continue to move, compressing the spring by 35.0 cm before the whole system momentarily comes to a stop. Assuming that the surface on which the block is resting is frictionless, determine the mass of the wooden block. From left to right, a bullet of mass m subscript b has a velocity of v subscript b with a velocity vector pointing directly to the right. The vector points toward a block that is attached on its right face to a spring of force constant k. The other end of the spring is attached to a fixed, vertical surface. mass of wooden block: kg

In: Physics

A novelty collision device known as the executive toy consists of five identical metal balls. When...

A novelty collision device known as the executive toy consists of five identical metal balls. When one ball swings in, after multiple collisions, one ball swings out at the other end of the row of balls. When two balls swing in, two swing out; when three swing in, three swing out, and so on-always the same number out as in. Suppose that one ball, with mass m, swing in and collide with the next ball with a velocity v. Why don’t two ball swing out at the other end with a velocity of v/2? Clearly establish the reasoning and physical principles to receive full credit.

Can someone explain to me what laws are being used here and how it relates to the question? Thank you.

In: Physics