Case: Mini Case - Temp Force, Respond to Questions a, b, d, and e (1, 2, 3, 4).

Your employer, a midsized human resources management company, is considering expansion into related fields, including the acquisition of Temp Force Company, an employment agency that supplies word processor operators and computer programmers to businesses with temporarily heavy workloads. Your employer is also considering the purchase of Biggerstaff & McDonald (B&M), a privately held company owned by two friends, each with 5 million shares of stock. B&M currently has free cash flow of $24 million, which is expected to grow at a constant rate of 5%. B&M’s financial state-ments report short-term investments of $100 million, debt of $200 million, and preferred stock of $50 million. B&M’s weighted average cost of capital (WACC) is 11%. Answer the following questions:

a. Describe briefly the legal rights and privileges of common stockholders.

b. What is free cash flow (FCF)? What is the weighted average cost of capital? What is the free cash flow valuation model?

c. Use a pie chart to illustrate the sources that comprise a hypothetical company’s total value. Using another pie chart, show the claims on a company’s value. How is equity a residual claim?

d. Suppose the free cash flow at Time 1 is expected to grow at a constant rate of gL forever. If gL cash flows when discounted at the WACC? If the most recent free cash flow is expected to grow at a constant rate of gL , WACC), what is a formula for the present value of expected free cash flows when discounted at the WACC?

e. Use B&M’s data and the free cash flow valuation model to answer the following questions:

(1) What is its estimated value of operations?

(2) What is its estimated total corporate value? (This is the entity value.)

(3) What is its estimated intrinsic value of equity?

29.The data suggests that global climate change stems from what human activity?

A)burning of fossil fuels   B)depleting the ozone layer   C)the burying of toxic wastes

D)the incineration of municipal wastes   E)a and b but not c and d

30.The number of individuals of a species that can be maintained in an area (by the resources in that area) over time is termed the area's:

A)maximum level  B)carrying capacity  C)stable peak  D)niche optimum  E)biotic potential

31. The idea that the City of New York would spend money to buy land around their reservoirs in the Catskills (because the land acts a natural filtration system) instead of spending money to build a water filtration plant to clean the water as it arrives in NYC from the reservoirs is an example of the recognition of….. (note: this is a highly simplified description)

A. law of conservation of matter        B. law of conservation of energy  C.  the 2^nd law of thermodynamics (the entropy law)    D. external costs   E. ecosystem services

32. Ecological diversity is a measure of the number of

A. different kinds of organisms within a community or ecosystem.

B. different versions of the same gene in an ecological community.

C. sizes, colors, and shapes of organisms within an ecological community.

D. trophic levels in a biological community.

E. different microhabitats in an ecosystem.

ACC101

Q1-

A company wants to implement good internal control. What are the policies and procedures you can suggest to minimize human frauds and errors?

Q2-

Assume that you have a company. And the management team estimates that 3% of sales will be uncollectible.

Give any amount of sales and prepare the journal entry using the percent of sales method.                                                                                              

Q3-

A company that uses a perpetual inventory system made the following cash purchases and sales. There was no beginning inventory.

A. Prepare general journal entries to record the March 16 sale using the

1. FIFO inventory valuation method.
2. LIFO inventory valuation method.
3. Weighted average valuation method.

B. What is the cost of goods sold and the gross margin for each method?

Q4. What is the bank reconciliation? why is it important for companies to prepare bank reconciliation periodically?   

ACC101

Q1-

A company wants to implement good internal control. What are the policies and procedures you can suggest to minimize human frauds and errors? (1Mark)

Q2-

Assume that you have a company. And the management team estimates that 3% of sales will be uncollectible.

Give any amount of sales and prepare the journal entry using the percent of sales method.                                                                                              (1Mark)

Q3-

A company that uses a perpetual inventory system made the following cash purchases and sales. There was no beginning inventory.

A.Prepare general journal entries to record the March 16 sale using the

1. FIFO inventory valuation method.
2. LIFO inventory valuation method.
3. Weighted average valuation method.

B. What is the cost of goods sold and the gross margin for each method? (2Marks)

Q4. What is the bank reconciliation? why is it important for companies to prepare bank reconciliation periodically?                                                                (1Mark)

2) In class, we investigated the problem of horizontal transfer of antibiotic genes between bacteria found in animals routinely fed antibiotics and bacteria that might affect human health. We focused on ermB gene that enables bacteria to resist the antibiotic erythromycin (A drug commonly used in both therapeutic and agricultural applications). Investigate the same biological problem by doing BLAST search for another potential gene. You need to mention whether you think that there is horizontal gene transfer between bacteria found in animals and bacteria that might affect human health based on your results.

Some potentially helpful information:

Antibiotic Erythromycin

We will focus on genes enabling bacteria to resist the antibiotic erythromycin

A drug commonly used in both therapeutic and agricultural applications

Query Sequence-ermB

As our query sequence, we use an erythromycin-resistance gene called ermB from Streptococcus agalactiae

ermB gene: accession number DQ355148.1

Identifying genes similar to ermB with BLAST

From the NCBI BLAST home page, paste or upload your S. agalactiae ermB sequence

NCBI BLAST home page

http://blast.ncbi.nlm.nih.gov/Blast.cgi?PRO GRAM=blastn&PAGE_TYPE=BlastSearch&LIN K_LOC=blasthome

Notice the section labeled Choose Search Set, where you can specify the sequences to be searched

Importantly, the default set of sequences is the subset of GenBank containing human DNA sequences

This obviously will not work in our case, where we want to retrieve bacterial sequences

Change the database to nucleotide collection (nr/nt), which will search all the unique (“nonredundant” or nr) sequences in GenBank

Many sequences in GenBank are from bacteria that have been sequenced (using DNA harvested from an environmental sample) but never cultured; these are not useful to us because we do not know what species they come from

So check the box to exclude sequences from uncultured samples

There is also an input box where you can limit your search to a particular organism or group of organisms

you could type “bacteria” here to exclude any nonbacterial sequences that might happen to match

Choose blastn for now to see both very similar and less-similar sequences the program might identify

Click the BLAST button to start the search and compare your ermB sequence with the selected sequences

The top-matching sequences are extremely similar

Such similar sequences found in many different species strongly suggests horizontal gene transfer rather than mutation over a long time of descent from a common ancestor

Retrieving Sequences

We will carry out a multiple alignment of some ermB genes from different species, which requires retrieving their sequences in FASTA format

Sequences

Streptococcus_pneumoniae: A significant human pathogenic bacterium

Staphylococcus_aureus: fish pathogen affecting saltwater fish

Lactococcus_garvieae: frequently found in the nose, respiratory tract, and on the skin

Bacillus_cereus: commonly found in soil and food

The Data

CH04FileofdiverseermBsequencessuitablefort heClustalanalysis.txt

ClustalW

http://www.ebi.ac.uk/Tools/msa/clustalw2/

http://clustalw.ddbj.nig.ac.jp/

>Streptococcus_pneumoniae
ATGAACAAAAATATAAAATATTCTCAAAACTTTTTAACGAGTGAAAAAGTACTCAACCAAATAATAAAAC
AATTGAATTTAAAAGAAACCGATACCGTTTACGAAATTGGAACAGGTAAAGGGCATTTAACGACGAAACT
GGCTAAAATAAGTAAACAGGTAACGTCTATTGAATTAGACAGTCATCTATTCAACTTATCGTCAGAAAAA
TTAAAACTGAACATTCGTGTCACTTTAATTCACCAAGATATTCTACAGTTTCAATTCCCTAACAAACAGA
GGTATAAAATTGTTGGGAATATTCCTTACCATTTAAGCACACAAATTATTAAAAAAGTGGTTTTTGAAAG
CCATGCGTCTGACATCTATCTGATTGTTGAAGAAGGATTCTACAAGCGTACCTTGGATATTCACCGAACA
CTAGGGTTGCTCTTGCACACTCAAGTCTCGATTCAGCAATTGCTTAAGCTGCCAGCGGAATGCTTTCATC
CTAAACCAAAAGTAAACAGTGTCTTAATAAAACTTACCCGCCATACCACAGATGTTCCAGATAAATATTG
GAAGCTATATACGTACTTTGTTTCAAAATGGGTCAATCGAGAATATCGTCAACTGTTTACTAAAAATCAG
TTTCATCAAGCAATGAAACACGCCAAAGTAAACAATTTAAGTACCGTTACTTATGAGCAAGTATTGTCTA
TTTTTAATAGTTATCTATTATTTAACGGGAGGAAATAA
>Staphylococcus_aureus
ATGAACAAAAATATAAAATATTCTCAAAACTTTTTAACGAGTGAAAAAGTACTCAACCAAATAATAAAAC
AATTGAATTTAAAAGAAACCGATACCGTTTACGAAATTGGAACAGGTAAAGGGCATTTAACGACGAAACT
GGCTAAAATAAGTAAACAGGTAACGTCTATTGAATTAGACAGTCATCTATTCAACTTATCGTCAGAAAAA
TTAAAACTGAACATTCGTGTCACTTTAATTCACCAAGATATTCTACAGTTTCAATTCCCTAACAAACAGA
GGTATAAAATTGTTGGGAATATTCCTTACCATTTAAGCACACAAATTATTAAAAAAGTGGTTTTTGAAAG
CCATGCGTCTGACATCTATCTGATTGTTGAAGAAGGATTCTACAAGCGTACCTTGGATATTCACCGAACA
CTAGGGTTGCTCTTGCACACTCAAGTCTCGATTCAGCAATTGCTTAAGCTGCCAGCGGAATGCTTTCATC
CTAAACCAAAAGTAAACAGTGTCTTAATAAAACTTACCCGCCATACCACAGATGTTCCAGATAAATATTG
GAAGCTATATACGTACTTTGTTTCAAAATGGGTCAATCGAGAATATCGTCAACTGTTTACTAAAAATCAG
TTTCATCAAGCAATGAAACACGCCAAAGTAAACAATTTAAGTACCGTTACTTATGAGCAAGTATTGTCTA
TTTTTAATAGTTATCTATTATTTAACGGGAGGAAATAA
>Lactococcus_garvieae
ATGAACAAAAATATAAAATATTCTCAAAACTTTTTAACGAGTGAAAAAGTACTCAACCAAATAATAAAAC
AATTGAATTTAAAAGAAACCGATACCGTTTACGAAATTGGAACAGGTAAAGGGCATTTAACGACGAAACT
GGCTAAAATAAGTAAACAGGTAACGTCTATTGAATTAGACAGTCATCTATTCAACTTATCGTCAGAAAAA
TTAAAACTGAACATTCGTGTCACTTTAATTCACCAAGATATTCTACAGTTTCAATTCCCTAACAAACAGA
GGTATAAAATTGTTGGGAATATTCCTTACCATTTAAGCACACAAATTATTAAAAAAGTGGTTTTTGAAAG
CCATGCGTCTGACATCTATCTGATTGTTGAAGAAGGATTCTACAAGCGTACCTTGGATATTCACCGAACA
CTAGGGTTGCTCTTGCACACTCAAGTCTCGATTCAGCAATTGCTTAAGCTGCCAGCGGAATGCTTTCATC
CTAAACCAAAAGTAAACAGTGTCTTAATAAAACTTACCCGCCATACCACAGATGTTCCAGATAAATATTG
GAAGCTATATACGTACTTTGTTTCAAAATGGGTCAATCGAGAATATCGTCAACTGTTTACTAAAAATCAG
TTTCATCAAGCAATGAAACACGCCAAAGTAAACAATTTAAGTACCGTTACTTATGAGCAAGTATTGTCTA
TTTTTAATAGTTATCTATTATTTAACGGGAGGAAATAA
>Streptococcus_pyogenes
ATGAACAAAAATATAAAATATTCTCAAAACTTTTTAACGAGTGAAAAAGTACTCAACCAAATAATAAAAC
AATTGAATTTAAAAGAAACCGATACCGTTTACGAAATTGGAACAGGTAAAGGGCATTTAACGACGAAACT
GGCTAAAATAAGTAAACAGGTAACGTCTATTGAATTAGACAGTCATCTATTCAACTTATCGTCAGAAAAA
TTAAAACTGAACATTCGTGTCACTTTAATTCACCAAGATATTCTACAGTTTCAATTCCCTAACAAACAGA
GGTATAAAATTGTTGGGAATATTCCTTACCATTTAAGCACACAAATTATTAAAAAAGTGGTTTTTGAAAG
CCATGCGTCTGACATCTATCTGATTGTTGAAGAAGGATTCTACAAGCGTACCTTGGATATTCACCGAACA
CTAGGGTTGCTCTTGCACACTCAAGTCTCGATTCAGCAATTGCTTAAGCTGCCAGCGGAATGCTTTCATC
CTAAACCAAAAGTAAACAGTGTCTTAATAAAACTTACCCGCCATACCACAGATGTTCCAGATAAATATTG
GAAGCTATATACGTACTTTGTTTCAAAATGGGTCAATCGAGAATATCGTCAACTGTTTACTAAAAATCAG
TTTCATCAAGCAATGAAACACGCCAAAGTAAACAATTTAAGTACCGTTACTTATGAGCAAGTATTGTCTA
TTTTTAATAGTTATCTATTATTTAACGGGAGGAAATAA
>Bacillus_cereus
ATGAACAAAAATATAAAATATTCTCAAAACTTTTTAACGAGTGAAAAAGTACTCAACCAAATAATAAAAC
AATTGAATTTAAAAGAAACCGATACCGTTTACGAAATTGGAACAGGTAAAGGGCATTTAACGACGAAACT
GGCTAAAATAAGTAAACAGGTAACGTCTATTGAATTAGACAGTCATCTATTCAACTTATCGTCAGAAAAA
TTAAAACTGAACATTCGTGTCACTTTAATTCACCAAGATATTCTACAGTTTCAATTCCCTAACAAACAGA
GGTATAAAATTGTTGGGAATATTCCTTACCATTTAAGCACACAAATTATTAAAAAAGTGGTTTTTGAAAG
CCATGCGTCTGACATCTATCTGATTGTTGAAGAAGGATTCTACAAGCGTACCTTGGATATTCACCGAACA
CTAGGGTTGCTCTTGCACACTCAAGTCTCGATTCAGCAATTGCTTAAGCTGCCAGCGGAATGCTTTCATC
CTAAACCAAAAGTAAACAGTGTCTTAATAAAACTTACCCGCCATACCACAGATGTTCCAGATAAATATTG
GAAGCTATATACGTACTTTGTTTCAAAATGGGTCAATCGAGAATATCGTCAACTGTTTACTAAAAATCAG
TTTCATCAAGCAATGAAACACGCCAAAGTAAACAATTTAAGTACCGTTACTTATGAGCAAGTATTGTCTA
TTTTTAATAGTTATCTATTATTTAACGGGAGGAAATAA
>Clostridium_difficile
ATGAACAAAAATATAAAATATTCTCAAAACTTTTTAACGAGTGAAAAAGTACTCAACCAAATAATAAAAC
AATTGAATTTAAAAGAAACCGATACCGTTTACGAAATTGGAACAGGTAAAGGGCATTTAACGACGAAACT
GGCTAAAATAAGTAAACAGGTAACGTCTATTGAATTAGACAGTCATCTATTCAACTTATCGTCAGAAAAA
TTAAAACTGAACATTCGTGTCACTTTAATTCACCAAGATATTCTACAGTTTCAATTCCCTAACAAACAGA
GGTATAAAATTGTTGGGAGTATTCCTTACCATTTAAGCACACAAATTATTAAAAAAGTGGTTTTTGAAAG
CCATGCGTCTGACATCTATCTGATTGTTGAAGAAGGATTCTACAAGCGTACCTTGGATATTCACCGAACA
CTAGGGTTGCTCTTGCACACTCAAGTCTCGATTCAGCAATTGCTTAAGCTGCCAGCGGAATGCTTTCATC
CTAAACCAAAAGTAAACAGTGTCTTAATAAAACTTACCCGCCATACCACAGATGTTCCAGATAAATATTG
GAAGCTATATACGTACTTTGTTTCAAAATGGGTCAATCGAGAATATCGTCAACTGTTTACTAAAAATCAG
TTTCATCAAGCAATGAAACACGCCAAAGTAAACAATTTAAGTACCGTTACTTATGAGCAAGTATTGTCTA
TTTTTAATAGTTATCTATTATTTAACGGGAGGAAATAA
>Escherichia_coli_O102
ATGAACAAAAATATAAAATATTCTCAAAACTTTTTAACGAGTGAAAAAGTACTCAACCAA
ATAATAAAACAATTGAATTTAAAAGAAACCGATACCGTTTACGAAATTGGAACAGGTAAA
GGGCATTTAACGACGAAACTGGCTAAAATAAGTAAACAGGTAACGTCTATTGAATTAGAC
AGTCATCTATTCAACTTATCGTCAGAAAAATTAAAACTGAATACTCGTGTCACTTTAATT
CACCAAGATATTCTACAGTTTCAATTCCCTAACAAACAGAGGTATAAAATTGTTGGGAAT
ATTCCTTACCATTTAAGCACACAAATTATTAAAAAAGTGGTTTTTGAAAGCCATGCGTCT
GACATCTATCTGATTGTTGAAGAAGGATTCTACAAGCGTACCTTGGATATTCACCGAACA
CTAGGGTTGCTCTTGCACACTCAAGTCTCGATTCAGCAATTGCTTAAGCTGCCAGCGGAA
TGCTTTCATCCTAAACCAAGAGTAAACAGTGTCTTAATAAAACTTACCCGCCATACCACA
GATGTTCCAGATAAATATTGGAAGCTATATACGTACTTTGTTTCAAAATGGGTCAATCGA
GAATATCGTCAACTGTTTACTAAAAATCAGTTTCATCAAGCAATGAAACACGCCAAAGTA
AACAATTTAAGTACCGTTACTTATGAGCAAGTATTGTCTATTTTTAATAGTTATCTATTA
TTTAACGGGAGGAAATAA
>Bacteroides_uniformus
ATGAACAAAAATATAAAATATTCTCAAAACTTTTTAACGAGTGAAAAAGTACTCAACCAAATAATAAAAC
AATTGAATTTAAAAGAAACCGATACCGTTTACGAAATTGGAACAGGTAAAGGGCATTTAACGACGAAACT
GGCTAAAATAAGTAAACAGGTAACGTCTATTGAATTAGACAGTCATCTATTCAACTTATCGTCAGAAAAA
TTAAAACTGAATACTCGTGTCACTTTAATTCACCAAGATATTCTACAGTTTCAATTCCCTAACAAACAGA
GGTATAAAATTGTTGGGAGTATTCCTTACCATTTAAGCACACAAATTATTAAAAAAGTGGTTTTTGAAAG
CCATGCGTCTGACATCTATCTGATTGTTGAAGAAGGATTCTACAAGGGTACCTTGGATATTCACCGAACA
CTAGGGTTGCTCTTGCACACTCAAGTCTCGATTCAGCAATTGCTTAAGCTGCCAGCGGAATGCTTTCATC
CTAAACCAAAAGTAAACAGTGTCTTAATAAAACTTACCCGCCATACCACAGATGTTCCAGATAAATATTG
GAAGCTATATACGTACTTTGTTTCAAAATGGGTCAATCGAGAATATCGTCAACTGTTTACTAAAAATCAG
TTTCATCAAGCAATGAAACACGCCAAAGTAAACAATTTAAGTACCGTTACTTATGAGCAAGTATTGTCTA
TTTTTAATAGTTATCTATTATTTAACGGGAGGAAATAA
>Escherichia_coli
ATGAACAAAAATATAAAATATTCTCAAAACTTTTTAACGAGTGAAAAAGTACTCAACCAAATAATAAAAC
AATTGAATTTAAAAGAAACCGATACCGTTTACGAAATTGGAACAGGTAAAGGGCATTTAACGACGAAACT
GGCTAAAATAAGTAAACAGGTAACGTCTATTGAATTAGACAATCATCTATTCAACTTATCGTCAGAAAAA
TTAAAACTGAATACTCGTGTCACTTTAATTCACCAAGATATTCTACAGTTTCAATTCCCTAACAAACAGA
GGTATAAAATTGTTGGGAATATTCCTTACCATTTAAGCACACAAATTATTAAAAAAGTGGTTTTTGAAAG
CCATGCGTCTGACATCTATCTGATTGTTGAAGAAGGATTCTACAAGCGTACCTTGGATATTCACCGAACA
CTAGGGTTGCTCTTGCACACTCAAGTCTCGATTCAGCAATTGCTTAAGCTGCCAGCGGAATGCTTTCATC
CTAAACCAAGAGTAAACAGTGTCTTAATAAAACTTACCCGCCATACCACAGATGTTCCAGATAAATATTG
GAAGCTATATACGTACTTTGTTTCAAAATGGGTCAATCGAGAATATCGTCAACTGTTTACTAAAAATCAG
TTTCATCAAGCAATGAAACACGCCAAAGTAAACAATTTAAGTACCGTTACTTATGAGCAAGTATTGTCTA
TTTTTAATAGTTATCTATTATTTAACGGGAGGAAATAA

Problem-based Scenario –

Your client, Sonny Days Limited (Sonny Days) is a company involved in the manufacture and development of play equipment for parks, schools and other bodies such as local authorities, councils and community groups. Sonny Days was set up in Ireland five years ago with support from government grants for employment costs and capital equipment costs. The company’s employee numbers continue to expand from a starting base of 15 employees.

As external auditors to Sonny Days, your firm’s audit approach has been to carry out an interim audit approximately ten months into the company’s financial year; followed by the final audit, which generally commences six weeks after the year-end. As a newly appointed Audit Senior you have been given managerial responsibility for this assignment and are currently reviewing the audit papers which were prepared during the interim audit visit to Sonny Days.

You met with the Audit Manager for the interim audit and he has indicated to you that from his interim audit work on the payroll processing and accounting system, the system does not employ the full extent of controls, which are evident in other companies of similar size and complexity. He has copied for you comprehensive system notes which he prepared during the interim audit.

These notes are reproduced below:

“Sonny Days operates a number of payrolls, the largest of which is the “manufacturing” payroll which deals with approximately 40 employees. Manufacturing employees are paid a standard weekly wage for a 35-hour working week. However, overtime is worked by most employees and can significantly boost weekly earnings.

All manufacturing employees are required to account for their time on a daily basis. This process involves employees logging time spent on particular activities into keypads located throughout the factory. Production Supervisors provide hard copy information to

the Human Resources Department for those employees on leave and this is used to compare employees logged in against total manufacturing staff numbers. Any discrepancies should be followed up. However, this hasn’t been done for several months due to a backlog of work in the Human Resources Department in addition to Production Supervisors not providing the hard copy reports in a timely manner.

In addition, all employees complete time-sheets each week recording their standard and over-time hours. These are then forwarded to the Human Resources Department where they are manually entered into the payroll processing system. If a time-sheet is not received, the standard hours for the week are automatically generated by the system.

The payroll is then run and the payslips and automatically generated cheques are produced. These are given to the Production Supervisors who hold them for collection by the individual employees. The payroll system is integrated with the nominal ledger and it generates a payroll expense split into production and non production accounts in addition to a charge in the wages liability account and the creation of liabilities for net pay, statutory and voluntary deductions. The balance on the payroll liability account is expensed quarterly. There are no hard copy reports produced by the system.

The payroll programme uses both input hours and information sourced from the employees’ master file. The master file is updated regularly for new employees, changes to tax free allowances, new rates of pay, changes in voluntary deductions, etc. Changes are accumulated each week and processed by payroll department staff. Changes are stamped within the system and flagged with the Human Resources Department User I.D. and password which are common to all payroll staff. Changes are investigated if there are employee queries.

A separate payroll bank account is maintained and is funded by weekly transfers equal to total gross pay. All payroll related payments are made from this account.

Any balances outstanding on the various deduction accounts are written off as part of the process for preparing annual accounts each year. Any balance on the wages bank account is transferred back to the main bank account”.

Required:

(b) Sonny Days Ltd. maintains a separate bank account for its payroll expense. Identify and explain SIX (6) benefits that may be derived from using such a system?

QUESTION 26

Matt has a health care plan that provides him coverage in such a way that allows him to be involved in making decisions to help lower costs. This plan typically includes insurance with a high deductible, a health savings account, and ongoing health education. Which type of health care plan is Matt using?

QUESTION 8

Dave wants to set up a manufacturing unit, so he meets with Rodney, a human resource manager at his company. Rodney explains that in order to decide on the human resource needs for the unit, they should conduct a work flow analysis. He suggests they start by defining the outputs of the process. To do this, which of the following should Dave define?

QUESTION 12

1.         East Bay Hospital was concerned about rising costs for patients who have surgery for joint replacement. It tried rewarding staff in any quarter they met targets for lower use of supplies, but costs continued to rise. An investigation showed that one source of costs was the readmission of patients who experienced infections after surgery. The human resource department proposed setting up a gainsharing program with an effectiveness measure related to reducing infections. Which statement about gainsharing best supports this recommendation?

2 points   

QUESTION 13

1.         Gabriela, an HR manager, and her staff devote long hours to planning and running a "benefits fair," where employees can view displays and ask questions about the various parts of the company's benefits package. The following week, the marketing manager asks if the effort was worthwhile. Gabriela says it was. What is the most likely reason for Gabriela's opinion?

QUESTION 31

1.         Penta Toy Corp. is a firm that manufactures toys. Very often, employees of the firm are on leave, citing physical strain as the cause. An expert hired by the company investigates the situation and recommends investing in an ergonomics study of the work environment. In this scenario, the expert is recommending

2 points   

QUESTION 28

N-Pax Technology Corp., a microchip manufacturing company, is hiring for the position of marketing manager for its new division. Nathan, the HR manager, considers the requirements of the job, including the necessary knowledge, level of proficiency, enduring capabilities, and other personality traits, such as persistence or motivation to achieve. Which of the following documents includes these considerations to help Nathan in selecting a candidate?

Case for Analysis: Change at Defence Research and Development—DRDC Toronto DRDC Toronto is a research centre whose mission is “to ensure that the Canadian Defence and National Security capabilities exploit the full potential of Human Effectiveness S&T [science and technology].” It is one of nine centres across Canada that are governed by several core values: trust and respect, commitment, client focus, creativity and innovation, teamwork, leadership, and professionalism and integrity. DRDC Toronto was founded in 1939 when the Department of National Defence (DND) recognized the importance of human factors by establishing the interdepartmental Associate Committee on Aviation Medical Research. Sir Frederick Banting, the co-discoverer of insulin, chaired the committee. DRDC Toronto has built on its early history of scientific excellence in human factors design and now serves both the Canadian forces and industrial clients with an internationally recognized combination of research facilities and expertise. DRDC Toronto has developed a range of S&T products and processes for military and industrial clients. For example, its diving tables are used around the world to reduce the risk of decompression sickness; the STING (Sustained Tolerance to INcreased G) system, provides superior G protection to jet fighter pilots; and the “Clothe the Soldier” project provided human engineering support to the Canadian Army in acquiring over 24 new items of state-of-the-art soldier protective clothing and personal equipment. These are just a few of the projects DRDC Toronto has been involved in but they are illustrative of the range and the variety of its work.1 DRDC Toronto began “a change journey” to design an organization that both integrated and acknowledged its scientific expertise while becoming more efficient and relevant to its military client. It was a particularly challenging change as there were various stakeholders within the organization who had different mental maps that shaped their behaviour. As Exhibit 10.10 shows, a mix of military, scientific, technical, and administrative staff reported ultimately to the director general, a well- published researcher in psychology. However, the military members (Canadian Forces personnel) also reported through a separate chain of command to the military commanding officer and associate director general. Dr. Pigeau was the change agent for DRDC Toronto’s “Partnership through Professionalism”—an initiative designed to promote an organizational culture of mutual respect so that all staff worked together collaboratively. He brought in external consultants as well as engaging his own personnel. He wanted to create a community of professionals dedicated to using and sharing its expertise to work on projects that would have direct and lasting benefits for its clients. The organization was to become client-driven rather than remaining a largely “silo-ed” organization where scientists did pure research of interest to them. Besides, the organization was to become better integrated and more cohesive while still recognizing the professional expertise of the various units. As part of its change, the Professional Partnership Initiative (PPI) recognized four professional streams—corporate, technical, science, and management—which cut across the hierarchy and affected both military and civilian staff. Each stream has members at different levels of experience who also have roles and responsibilities that are distinct to the stream. What is key in the design is that each stream is considered to be of equal value in serving the goals of DRDC Toronto’s clients. The streams do not replace the organization’s design (illustrated in Exhibit 10.10) nor do they challenge the military chain of command. “Rather, [the system of streams] complements it by allowing members of professional streams, civilian and military, to see how their efforts yield tangible, mission-specific effects.”2 The organizational design has two dimensions, vertical and horizontal, that establish task accountability and unity of effort, respectively. According to Dr. Pigeau, the PPI will be a successful change when it has achieved three significant outcomes: each professional stream will be able (1) to self-organize, (2) to partner well with other streams, and (3) to contribute directly to achieving the mission and vision of DRDC Toronto. See Exhibit 10.11 for observations from one member of each stream

1. What are the change challenges for DRDC Toronto?

please answer all :)

1. Suppose there is a mutation in the c subunit of ATP synthase, such that glutamate found in the middle of one of the membrane-spanning helices is converted to valine. What is likely to be the effect on ATP synthesis and why?

Inhibition of ATP synthesis. Because valine is hydrophobic, the a subunit will move in the reverse direction, causing hydrolysis, not synthesis, of ATP.

Inhibition of ATP synthesis. Valine cannot bind a proton, so there will be no proton flow through the inner membrane.

No effect. The middle of the helix is in contact with the hydrophobic center of the lipid bilayer, and valine is readily soluble in lipid.

Increase of ATP synthesis. Because the valine side chain is hydrophobic, the asubunit can move easily without regard for oxidative processes.

No effect. The valine side chain is shorter than the glutamate side chain, so it causes no change in the secondary structure of the helix.

2. What statement is incorrect about the mitochondrial ATP synthesizing complex?

It contains a transmembrane proton channel.

It contains a spherical headpiece called F1 located on the cytoplasmic side of the inner mitochondrial membrane.

It requires intact inner mitochondrial membranes to synthesize ATP.

The complex hydrolyzes ATP when the inner mitochondrial membranes are disrupted or leaky.

3. What coenzyme of the PDH complex functions as a "flexible swinging arm" when it transfers the reaction intermediate from one active site to the other?

lipoamide

thiamine pyrophosphate

coenzyme A

FAD

NAD+

4. What enzyme catalyzes the first redox reaction of the tricarboxylic acid cycle?

α-ketoglutarate dehydrogenase

isocitrate dehydrogenase

malate dehydrogenase

isocitrate lyase

pyruvate dehydrogenase

Consider the standard free energies shown below(T =37 C, R=8.3145 J/mole K) :

UDP-Mannose + H2O → Mannose 1-phosphate + UMP + 2H+ delta G' = -34.9 kJ/mol

UTP + H2O → UMP + PPi + 2H+ delta G' = -32.5 kJ/mol

PPi + H2O → 2Pi delta G' = -33.6 kJ/mol

(A) ( 2 pts) Calculate delta G' & Keq’ for the following reaction.

Mannose 1-phosphate + UTP + H2O → UDP-mannose + 2Pi

(B) ( 2 pts) Which of the following statements best describe this reaction?

(A)The reaction is irreversible under standard conditions.

(B) The reaction is reversible under standard conditions.

(C) The reaction is at equilibrium under intracellular conditions.

(D)The reaction is reversible under intracellular conditions.

(E) K’eq = 0

(C) (2 pts) This reaction is catalyzed by phosphomannose pyrophosphorylase. How would this enzyme effect delta G' and Keq’?

(D) ( 3 pts) The physiological concentration of these three metabolites in a mammalian cell at physiological temperature ( 37 C) are: [UDP-mannose] = 0.130 mM; [UMP] = 0.140 mM , [H2O ] = 55.6 M, [H+ ] = 10^-7 M and [mannose 1-phosphate] = 2.33 mM [UTP] = 4.35 mM; [Pi] = 8.90 mM [PPi] = 8.14 microM

What would be the actual free energy change (delta G) for the reaction under these cellular conditions?

Mannose 1-phosphate + UTP + H2O → UDP-mannose + 2Pi