Questions
You are a new Athletic Director at a small Division II university. The athletic program that...

You are a new Athletic Director at a small Division II university. The athletic program that you are taking over has been in a shambles (i.e. losing records, ineffective leadership, conflict among the different departments) for the last several years. The president of the university is bringing you in to clean up the program and change its direction. In addition, as mentioned there are conflicts between departments with the worst being between the head baseball and football coaches. Football has received according to the baseball coach all the resources while only producing mediocre results on and off the field. The baseball team has been more successful but has received very few resources. The baseball coach feels like he is under-resourced in scholarships, staffing, and budget for several years compared to football. The baseball stadium is run down, with very little seating, but football just had a new stadium built which is still only half full for games. The football coach continues to want more and often enjoys receiving resources at the expense of baseball. (Both of the coaches are currently under long term contracts so firing is not an option.)

1. Explain what 4 different leadership styles that could be used in this situation and why. What leadership approach do you think is best?

2. Using strategic management outline how you would attempt to accomplish this task?

In: Operations Management

You are a new Athletic Director at a small Division II university. The athletic program that...

You are a new Athletic Director at a small Division II university. The athletic program that you are taking over has been in a shambles (i.e. losing records, ineffective leadership, conflict among the different departments) for the last several years. The president of the university is bringing you in to clean up the program and change its direction. In addition, as mentioned there are conflicts between departments with the worst being between the head baseball and football coaches. Football has received according to the baseball coach all the resources while only producing mediocre results on and off the field. The baseball team has been more successful but has received very few resources. The baseball coach feels like he is under-resourced in scholarships, staffing, and budget for several years compared to football. The baseball stadium is run down, with very little seating, but football just had a new stadium built which is still only half full for games. The football coach continues to want more and often enjoys receiving resources at the expense of baseball. (Both of the coaches are currently under long term contracts so firing is not an option.)

1. Explain what 4 different leadership styles that could be used in this situation and why. What leadership approach do you think is best?

2. Using strategic management outline how you would attempt to accomplish this task?

In: Operations Management

An electric utility is considering a new power plant in northern Arizona. Power from the plant...

An electric utility is considering a new power plant in northern Arizona. Power from the plant would be sold in the Phoenix area, where it is badly needed. Because the firm has received a permit, the plant would be legal; but it would cause some air pollution. The company could spend an additional $40 million at Year 0 to mitigate the environmental problem, but it would not be required to do so. The plant without mitigation would require an initial outlay of $209.80 million, and the expected cash inflows would be $70 million per year for 5 years. If the firm does invest in mitigation, the annual inflows would be $75.33 million. Unemployment in the area where the plant would be built is high, and the plant would provide about 350 good jobs. The risk adjusted WACC is 17%.


Calculate the NPV and IRR with mitigation. Enter your answer for NPV in millions. For example, an answer of $10,550,000 should be entered as 10.55. Negative values, if any, should be indicated by a minus sign. Do not round intermediate calculations. Round your answers to two decimal places.

NPV: $   million

IRR: %

Calculate the NPV and IRR without mitigation. Enter your answer for NPV in millions. For example, an answer of $10,550,000 should be entered as 10.55. Negative values, if any, should be indicated by a minus sign. Do not round intermediate calculations. Round your answers to two decimal places.

NPV: $   million

IRR: %


In: Finance

Server-Side Attacks In today’s globally connected cyber community, network and OS level attacks are well defended...

Server-Side Attacks

In today’s globally connected cyber community, network and OS level attacks are well defended through the proper deployment of technical security controls such as, firewalls, IDS, Data Loss Prevention, Endpoint and security. However, web servers are accessible from anywhere on the web, making them vulnerable to attack.

1. What is the process called that cleans and scrubs user input in order to prevent it from exploiting security holes by proactively modifying user input.

2. Name the process that tests user and application-supplied input. The process is designed to prevent malformed data from entering a data information system by verifying user input meets a specific set of criteria (i.e. a string that does not contain standalone single quotation marks).

3. Secure SDLC is the process of ensuring security is built into web applications throughout the entire software development life cycle. Name three reasons why organization might fail at producing secure web applications.

4. How might an attacker exploit the robots.txt file on a web server?

5. What steps can an organization take to obscure or obfuscate their contact information on domain registry web sites?

6. True or False: As a network defender, Client-Side validation is preferred over Server-Side validation because it's easier to defend against attacks.

  • Explain why you chose the answer that you did.

In: Computer Science

A hospital has a large number of registered physicians. Attributes of PHYSICIAN include Physician ID (the...

A hospital has a large number of registered physicians. Attributes of PHYSICIAN include Physician ID (the identifier) and specialty. Patients are admitted to the hospital by physicians. Attributes of PATIENT include patient ID(identifier) and patient name. Any patient who is admitted must have exactly one admitting physician. A physician may optionally admit any number of patients. Once admitted, a given patient must be treated by at least one physician. A particular physician may treat any number of patients or none at all. Whenever a patient is treated by a physician, the hospital wishes to record the details of the treatment (Treatment Detail). Components of Treatment Detail include date, time, and results.

Part C - UML Diagramming:

Recall the EER diagram you made for Medical Solutions Hospital in Part A.  Use Draw.io or Visio to construct a UML diagram from your EER diagram. The UML diagram should have spaces for both fields/attributes and methods. Both Visio and Draw.io have built-in templates for UML diagramming. Be sure to add the multiplicities (like cardinalities).

Include:

  • A method to get treatment results for a specific date
  • A method to get a patient name
  • A method to set a patient name
  • A method to get a physician name given a particular specialty

What is possible to express with a UML diagram that is not possible to express with an EER diagram? Are there any limitations compared to an EER diagram?

In: Computer Science

Question 2 PT 1: A manager is trying to decide whether to build a small, medium,...

Question 2

PT 1: A manager is trying to decide whether to build a small, medium, or large facility. Demand can be low, average, or high, with the estimated probabilities being 0.25, 0.40, and 0.35, respectively.

A small facility is expected to earn an after-tax net present value of just $18,000 if demand is low. If demand is average, the small facility is expected to earn $75,000; it can be increased to medium size to earn a net present value of $60,000. If demand is high, the small facility is expected to earn $75,000 and can be expanded to medium size to earn $60,000 or to large size to earn $125,000.

A medium-sized facility is expected to lose an estimated $25,000 if demand is low and earn $140,000 if demand is average. If demand is high, the medium-sized facility is expected to earn a net present value of $150,000; it can be expanded to a large size for a net payoff of $145,000.

If a large facility is built and demand is high, earnings are expected to be $220,000. If demand is average for the large facility, the present value is expected to be $125,000; if demand is low, the facility is expected to lost $60,000.

Which alternative is best, according to each of the following decision criterion?

a) Maximin

b) Maximax

c) Minimax regret

PT 2: Draw a decision tree for the three options described in Part 1. What should management do to achieve the highest expected payoff?

Please show work step-by-step. Thank you.

In: Operations Management

in C++, please show step by step with simple codes. thank you An application from Biology...

in C++, please show step by step with simple codes. thank you
An application from Biology
The only built-in function you can use is length.
1. As a starting point, write a piece of pseudocode for a function that finds a substring of a string. Your
function should take as input the string, the starting point of the desired substring, and the length of the desired substring. For example, substring(“abracadabra”, 3, 5) should return “acada”.

2. Turn your pseudocode from 1 into C++ code. Run your code with several outputs to be sure it’s right.

3. We may wish to look for occurrences of specific protein sequences (that correspond to certain traits) in a strand of DNA. For instance, if you were looking for the protein sequence "AATG" in the DNA strand "ATGCAGAAAGCTACGATCAATGATCGATC AATGGAT", you would find that it starts at index 18. Note that there is more than one match, but we’ve found the starting index of the first one.
Write a piece of pseudocode, using your function from 1 and 2, that finds the index of the start of the the first match of a given string protein within the string dna. In our example above, protein would be “AATG” and dna would be "ATGCAGAAAGCTACGATCAATGATCGATC AATGGAT".

4. Turn your pseudocode from 3 into C++ code. Run your code with several outputs to be sure it’s right.

In: Computer Science

Determine the inventory cost and the cost of merchandise sold by three methods. Round interim calculations to one decimal and final answers to the nearest whole dollar.

Periodic Inventory by Three Methods; Cost of Merchandise Sold 

The units of an item available for sale during the year were as follows: 

Jan. 1 Inventory 30 units @ $110 

Mar. 10 Purchase 70 units @ $120 

Aug. 30 Purchase 30 units @ $124 

Dec. 12 Purchase 70 units @ $128 


There are 80 units of the item in the physical inventory at December 31. The periodic inventory system is used. 

Determine the inventory cost and the cost of merchandise sold by three methods. Round interim calculations to one decimal and final answers to the nearest whole dollar. 

image.png


In: Accounting

An aircraft factory manufactures airplane engines. The unit cost C (the cost in dollars to make each airplane engine) depends on the number of engines made.

An aircraft factory manufactures airplane engines. The unit cost C (the cost in dollars to make each airplane engine) depends on the number of engines made. If x engines are made, then the unit cost is given by the function C(x)=0.1x^2 - 26 x 14,015 .How many engines must be made to minimize the unit cost? Do not round your answer.

In: Advanced Math

Pacific Ink had beginning work-in-process inventory of $1,005,960 on October 1. Of this amount, $423,500 was the cost of direct materials and $582,460 was the cost of conversion.

Pacific Ink had beginning work-in-process inventory of $1,005,960 on October 1. Of this amount, $423,500 was the cost of direct materials and $582,460 was the cost of conversion. The 61,000 units in the beginning inventory were 30 percent complete with respect to both direct materials and conversion costs.

During October, 128,000 units were transferred out and 43,000 remained in ending inventory. The units in ending inventory were 80 percent complete with respect to direct materials and 40 percent complete with respect to conversion costs. Costs incurred during the period amounted to $3,314,300 for direct materials and $4,022,730 for conversion.

Exercise 8-40 (Algo) Assign Costs to Goods Transferred Out and Ending Inventory: FIFO Method (LO 8-2, 5)

a-1. Compute the cost of goods transferred out and the cost of ending inventory using the FIFO method.

a-2. Is the ending inventory higher or lower under the weighted-average method compared to FIFO?

Can someone break down how to do this for me? Thank you

In: Accounting