True or False, explain your answer
a) Wave functions of identical bosons are completely symmetrical under permutations
b) Particle A has mass m and particle B has mass 100m. Both have the same kinetic energy
E. They are incident on an infinitely long potential step of magnitude V where V > E.
Particle B has a smaller probability of getting reflected than particle A.
c) A massive spin-3/2 particle can decay into a particle of spin-0 and a particle of spin-1/2.
d) A massive spin-1 particle can decay into a particle of spin-0 and a particle of spin-1/2.
e) The radial wave function of a hydrogen energy eigenstate with non-zero orbital angular momentum vanishes at the origin.
In: Physics
(THERMODYNAMICS) A vertical cylinder fitted with a frictionless piston contains 1.5 kg of H2O initially at 100 °C, 400 kPa. If the volume of the system reaches 0.5 m3, the piston hits a set of stops and is restrained from further upward travel. The system is heated to 200 C. (Use saturated water tables, steam tables, and superheated tables as necessary)
a) If the piston reaches the stops, determine the temperature and pressure when the piston first touches but exerts no force on the stops. If the piston doesn’t reach the stops, find the final volume. Clearly show how you determined whether or not the piston reaches the stops.
b) Calculate the heat and work for the entire process.
c) Show the entire process on a T-v and P-v diagram including the saturation curve.
In: Mechanical Engineering
1. In the U.S., what percentage of the energy used to generate
electricity is lost to conversion efficiencies?
i. 20%
ii. 30%
iii. 40%
iv. 50%
v. 60%
2. What is wind turbine coefficient of performance?
i. The ratio of tip speed to incoming wind speed
ii. The ratio of AC to DC turbine power
iii. The ratio of power extracted by the turbine to the rated
turbine power
iv. The ratio of the power extracted by the turbine to the power in
the wind
3. What is the maximum wind turbine power that can be harvested
using a wind turbine with a turbine radius = 0.2 m and wind speed =
3 m/s, air density = 1.23 kg/m3?
i. 0.23 W
ii. 0.41 W
iii. 0.70 W
iv. 0.82 W
v. 1.23 W
In: Mechanical Engineering
A closed and elevated vertical cylindrical tank with diameter 2.10 m contains water to a depth of 0.500 m . A worker accidently pokes a circular hole with diameter 0.0170 m in the bottom of the tank. As the water drains from the tank, compressed air above the water in the tank maintains a gauge pressure of 5.00×103 Pa at the surface of the water. Ignore any effects of viscosity.
A)Just after the hole is made, what is the speed of the water as it emerges from the hole? (v=____)
B)What is the ratio of this speed to the efflux speed if the top of the tank is open to the air? (v/vopen=________)
C)How much time does it take for all the water to drain from the tank? (t=_______)
D)What is the ratio of this time to the time it takes for the tank to drain if the top of the tank is open to the air? (t/topen=_______)
In: Physics
What is the final volume of each of the following diluted solutions?
A.8.0 % (m/v) H2SO4 solution prepared from 6.00 mL of a solution that is 19.0 % H2SO4
Express your answer in liters using two significant figures.
B.1.4 M HCl solution prepared from 11 mL of a solution that is 2.0 M HCl
Express your answer in liters using two significant figures.
C.1.0 M NaOH solution prepared from 60.0 mL of a solution that is 10.0 M NaOH
Express your answer in liters using two significant figures.
D.3.0 % (m/v) CaCl2 solution prepared from 20 mL of a solution that is 12.00 % CaCl2
Express your answer in liters using two significant figures.
In: Chemistry
Consider Dataset A for answering the questions that follows below. a. Calculate the measures of central tendencies for Variable X and Variable Y. i. Mean ii. Median iii. Mode iv. Midrange v. What can you say about the skewness of X and Y variables? b. Calculate the measures of variations for Variable X and Variable Y. i. Range ii. Variance iii. Standard Deviation iv. Coefficient of Variation v. Which is more variable, X or Y? Why? c. Calculate the measures of position for Variable X. i. Z-score of the mean value of X ii. Percentile rank of the maximum value of X iii. Check for any outliers in variable X
variable X:6,7,8,8,8,9,9,9,11,11
variableY: -2.77,-0.23,-0.29,-0.05,0.33,0.43,0.51,0.63,0.85,1.12
In: Statistics and Probability
A parallel plate capacitor with plate separation d is connected to a battery. The capacitor is fully charged to Q Coulombs and a voltage of V. (C is the capacitance and U is the stored energy.) Answer the following questions regarding the capacitor charged by a battery. For each statement below, select True or False.
1. With the capacitor connected to the battery, inserting a
dielectric with κ will increase C.
2. With the capacitor connected to the battery, decreasing d
increases C.
3. After being disconnected from the battery, decreasing d
increases U.
4. With the capacitor connected to the battery, decreasing d
decreases Q.
5. With the capacitor connected to the battery, inserting a
dielectric with κ will decrease U.
6. After being disconnected from the battery, inserting a
dielectric with κ will decrease V.
In: Physics
Below is a segment of coding sequence from the overlapping Ink4A-Arflocus (top line) and protein sequence from Ink4A(line 2, zero frame) and Arf(line 3, +2 frame).
caggtcatgatgatgggcagcgcccgagtggcggagctgctgctgctccacggcgcggag
Q V M M M G S A R V A E L L L L H G A E
G H D D G Q R P S G G A A A A P R R G
-What bases could be used to maintain this Leucine codon in Ink4A but mutate the Proline codon in Arf?
- What amino acid codons could be introduced into Arf Proline codon without changing the Ink4A Leucine codon?
- What mutant amino acids may be substrates for phosphorylation?
In: Biology
The magnetic field in a plane monochromatic electromagnetic wave with wavelength λ = 684 nm, propagating in a vacuum in the z-direction is described by
B⃗ =(B1sin(kz−ωt))(i^+j^)B→=(B1sin(kz−ωt))(i^+j^)
where B1 = 5.3 X 10-6 T, and i-hat and j-hat are the unit vectors in the +x and +y directions, respectively.
1)
What is k, the wavenumber of this wave?
m-1
2)
What is zmax, the distance along the positive z-axis to the position where the magnitude of the magnetic field is a maximum at t = 0?
nm
3)
What is Emax, the amplitude of the electric field oscillations?
V/m
4)
What is Ey, the y-component of the electric field at (x = 0, y-0, z = zmax) at t = 0?
V/m
In: Physics
A 4.0 µF capacitor and a 5.0 µF capacitor are connected in series across a 1.5 kV potential difference. The charged capacitors are then disconnected from the source and connected to each other with terminals of like sign together. Find the charge on each capacitor (in mC) and the voltage across each capacitor (in V). (Due to the nature of this problem, do not use rounded intermediate values in your calculations—including answers submitted in WebAssign.)
4.0 µF capacitor
charge 3.706mC Incorrect: Your answer is incorrect.
voltage 741.11 Correct: Your answer is correct.
V 5.0µF capacitor
charge 2.964mC Incorrect: Your answer is incorrect.
voltage 741.11 Correct: Your answer is correct.
MY ANSWERS ARE IN BOLD. CAN ANYONE EXPLAIN WHAT THE CORRECT ANSWER IS?
In: Physics