Bradford DeLong was the first to show that there is no significant evidence of countries’ levels of GDP per capita converging, nor of their growth rate. The first problem could easily be fixed within the Solow/Swan framework by adding additional factors of production such as human capital. Explain why such differences could explain differences of well-being (in terms of the model).

Business Strategic Management: Strategic Audit

Apple Inc.'s Internal Environment:

Can you summarize Apple Inc.'s, A. Marketing, B. Finance, C. Research & Development, D. Operations & Logistics, E. Human Resources, F. Information Technology, and a short summary of internal factors for Apple ? (A large response would be nice !!)

Average blood velocity is 11cm/s in the human ascending aorta. The average diameter of the aorta is 2.1cm.

a) How much blood passes through the aorta each day in gallons?

b) How does this compare to the total quantity of blood you have in your body?

c) If 45% of the aorta becomes clogged, what is the new blood velocity?

Explain how crossing over and independent assortment contributed to genetic variation. Your explanation should be based on ONE (1) living organism (you may choose any species that undergoes sexual reproduction as an example, except human).

The details of explanation should be concise and informative. The length of the explanation should be less than 500 words.                                                                                                

Upon discussion of the tensile data with other engineers you are advised that nanoindentation testing of the human cortical bone may be useful. What motivation is there for using nanoindentation for determining bone mechanical properties? Your answer should be no more than 250 words and you should cite any reference(s) you use to support your arguments.

2.. The diagram below illustrates the human DNA nucleotide sequence containing the somatostatin gene. (2)

• Highlight in red the bases between which EcoRI cuts on each strand of the DNA sequence.

• Highlight in turquoise the bases between which BamHI cuts each strand of the DNA sequence.

5’ 3’

GAATTCATGGCTGGTTGTAAGAACTTCTTTTGGAAGACTTTCACTTCGTGTTAGTAGGATCC

3’ 5’

CTTAAGTACCGACCAACATTCTTGAAGAAAACCTTCTGAAAGTGAAGCACAATCATCCTAGG

Describe the features of the gene organization and the gene structure between bacteria and human. How do these differences of genomic features provide evolutionary adaptations to prokaryotic and eukaryotic organismal functions.

Why are multiple specific bacterial tester strains used in the Ames test? Illustrate with a diagram, how can the toxic and mutagenic effects be distinguished from the anticipated results?

Discussion:

**In one's culture, the elderly and those with severe handicaps are put to death. it will appear that this culture does not recognize human dignity as a value?

** Copyright law makes it illegal to copy computer programs. Yet sometimes students wants or need a program that is too expensive for them to buy. In such cases, is it morally acceptable for students to copy a friend software?

What are the pros and cons of using technology and quantitative data to trace, monitor, and address human rights violations? Overall, do you think that the pros outweigh the cons or not? Why? Use specific examples from the slides and the book.

Answer this prompt in at least two or three paragraphs, clearly stating your argument and supporting the argument with evidence.