NEED THE COMPLETE AND CLEAR SOLUTION thanks

An isotonic solution will produce an osmotic pressure of 7.84 atm measured against pure water at human body temperature (37.0 °C). How many g of sodium chloride must be dissolved in a liter of water to produce an isotonic solution?

Journalize entries related to bank reconciliation and all adjusting entries

Whispering Winds Corp. prepares quarterly financial statements. The post-closing trial balance at December 31, 2021, is presented below.

During the first quarter of 2022, the following transactions occurred:

Bank reconciliation data and adjustment data:

QUESTION 15

1. Viruses lack abilities cellular life forms have including

   		a. Heredity
   		b. Protein binding
   		c. Evolution
   		d. A metabolism

2 points   

QUESTION 16

1. For this stretch of DNA: 5’ G C G T C A 3’

   The complementary DNA strand is

   		a. 5’ G C G T C A 3’
   		b. 3’ C G C U G T 5’
   		c. 5’ C G C A C U 3’
   		d. 3’ C G C A G T 5’

2 points   

QUESTION 17

1. This is the pedigree of a family with dry earwax syndrome, a single gene trait. Individuals with dry earwax often need professional flushing of the ear canals to avoid blockage. Individuals with dry earwax also have less body odor, and are less likely to get breast cancer. Affected individuals are colored circles and squares. Open circles and squares indicate those with normal wet earwax. What is the genotype of individual number 3 in generation II?

   		a. Homozygous dominant: normal earwax
   		b. Homozygous recessive: dry earwax
   		c. Heterozygous: normal carrier with wet earwax
   		d. Heterozygous: they are affected with dry earwax

2 points   

QUESTION 18

1. Transcription in eukaryotes requires which of the following in addition to RNA polymerase?

   		a. the protein product of the promoter
   		b. ribosomes and tRNA
   		c. start and stop codons
   		d. several transcription factors (TFs)

2 points   

QUESTION 19

1. What is the energy source for the DNA synthesis reaction?

   		a. ATP
   		b. GTP
   		c. Hydrolysis of amino acids
   		d. The dNTPs: dATP, dGTP, dCTP, and dTTP

2 points   

QUESTION 20

1. Which of the following represents a difference between viruses and prions?

   		a. Viruses infect many types of cells, whereas prions infect only prokaryotic cells.
   		b. Viruses have nucleic acids and protein, whereas prions are only protein.
   		c. Viruses contain introns, whereas prions have only exons.
   		d. Viruses always have genomes composed of DNA, whereas prions always have genomes composed of RNA.

2 points   

QUESTION 21

1. How do females compensate for having a double dose of all the genes on the X chromosome?

   		a. All the genes are down-regulated
   		b. One X chromosome is digested by nucleases
   		c. One X is inactivated in each female cell
   		d. Males duplicate their one X, so their cells actually have two X’s

2 points   

QUESTION 22

Hemophilia A is a recessive sex-linked disease characterized by the inability to form normal blood clots. Without medical treatment this disease is fatal. The “H” is a normal allele for blood clotting factor VIII, the “h” is the hemophilia allele for abnormal clotting factor. This Punnett square is from a family with the allele for Hemophilia A. What percentage of the daughters of this couple will suffer from Hemophilia?

2 points   

QUESTION 23

1. Which two alleles a person has for a particular gene is their:

   		a. Appearance
   		b. Phenotype
   		c. Genotype
   		d. Karyotype

2 points   

QUESTION 24

1. Sickle-cell anemia is a recessive genetic disease that is fatal in childhood without medical treatment. The frequency of carriers of the sickle-cell anemia allele is extremely high in sub-Saharan Africa, presumably because heterozygotes are less likely to die from childhood malaria infections. Such a relationship is probably due to:

   		a. Mendel's law of independent assortment
   		b. Mendel's law of segregation
   		c. Darwin's explanation of natural selection
   		d. the malarial parasite directly changing the allele

2 points   

QUESTION 25

1. People have always noticed there are traits in humans, plants, and animals that disappear and reappear over the generations. We now know these traits are due to:

   		a. Dominant alleles
   		b. Sex-linked traits
   		c. Incomplete dominance
   		d. Recessive alleles

2 points   

QUESTION 26

1. Most cold viruses are unaffected by alcohol-based hand sanitizers like Purell. Flu viruses are inactivated by hand-sanitizer. What might account for this difference?

   		a. Cold viruses don’t have receptors for alcohol
   		b. Flu viruses are alive, cold viruses aren’t
   		c. Cold viruses contain alcohol dehydrogenase
   		d. Flu viruses have a membranous capsule which is damaged by alcohol

2 points   

QUESTION 27

1. When an mRNA molecule is made from DNA, this process is called:

   		a. Translation
   		b. Transcription
   		c. Transposition
   		d. Teleportation

2 points   

6.) Which compound has the highest potential energy and produces the most ATP when completely oxidized?

a.  acetyl-CoA

b.  glucose

c.  pyruvate

d.  carbon

e.  both pyruvate and carbon

7.) Which is TRUE about amphipathic molecules when placed in an aqueous solution (water)?

a.  The interior portion is composed of hydrophilic hydrocarbon chains.

b.  The outside portion is composed of hydrophilic head groups.

c.  The interior portion is composed of hydrophobic hydrocarbon chains.

d.  Both A and B

e.  Both B and C

8.) On which of the following processes would a defective ribosome have the most detrimental effect?

a.  translation

b.  replication

c.  transcription

d.  replication and transcription

e.  replication and translation

9.) The formation of bilayers by phospholipids is driven by:

a. hydrogen bonding

b. hydrophobic effect

c. non-polar covalent bonding

d. all of the above

e. A and B

10.) C6H12O6 + 6O2 + ADP + Pi---> 6CO2 + 6H2O + ATP When is the majority of the carbon dioxide in this reaction produced?

a. glycolysis

b. Calvin cycle

c. Citric Acid cycle

d. conversion of pyruvate into acetyl-CoA

e. electron transport chain

1. Assume that you can measure the effects of identical concentration of two inhibitors x and Z, on the K and V M and Vmax of an Enzyme. Which of the following would be consistent with inhibitor X being a more effective inhibitor than Z?

2. Explain why an answer is either wrong/right.

a. Inhibitor X increases KM less than inhibitor Z while neither has an effect on V Max.

b. Inhibitor X decreases KM and VMax two-fold while inhibitor Z decreases both three-fold.

c. Inhibitor X doubles the KM and it decreases VMax by 50% while inhibitor Z triples the KM and it decreases the VMax by 40%.

d. Inhibitor X doubles the KM and it decreases VMax by 50% while inhibitor Z triples the KM and it decreases VMax by 10%.

PLEASE EXPLAIN THOROUGHLY!!!!!!!!!!!!!!!!!

1. In your own words, describe the process of DNA replication (include the proteins discussed in the lecture presentation in your description and identify their functions) (20pts)

2. Is DNA conservative or semiconservative? Explain. (10 pts)

3. In your own words, provide a detailed description of how DNA is packaged in the nucleus (10 pts).

4. Identify the process and detail the steps of transcription from start to finish (In your own words) (10pts)

5. RNA is derived from DNA by what process and which major enzyme? (5pts)

6. List three differences between RNA and DNA. (5pts)

7. What is the difference between Mitosis and Meiosis? (The process and cell types.) (10pts)

8. What is a nonsense mutation? (5 pts)

9. What determines if a gene is functional (5 pts)

10. How do mutations occur in cells? Further list 3 things that can increase the rate of mutations not discussed in lecture. (10 pts)

1. Most people who are completely blind have circadian rhythms that are “free running”; that is, their circadian rhythms are not synchronized to their environment time cues and they oscillate on a cycle of about 24.5 hours. Why do you suppose the circadian clocks of blind people are not entrained to the same 24-hour clock as the majority of the population? Can you guess what symptoms might be associated with a free-running circadian clock? Do you suppose that blind people have trouble sleeping?

2. When cells enter mitosis, their existing array of cytoplasmic microtubules has to be rapidly broken down and replaced with the mitotic spindle, which pulls the chromosomes into the daughter cells. The enzyme katanin, named after Japanese samurai swords, is activated during the onset of mitosis and cleaves to microtubules into short pieces. What do you suppose is the face of the microtubule fragments created by katanin?

The following questions are related to glucose and its transport into cells.
A. Why do cells need a protein to transport glucose across the cell membrane? i.e.could glucose simply diffuse across the lipid bilayer? (1 point)

B. Even after glucose is transported into the cell, there is effectively no increase in intracellular glucose concentration. This can be attributed to the action of hexokinase, the first enzyme in the glycolytic pathway. Explain. (2 points)

C. GLUT1 is a glucose transporter found in many cells. It facilitates the movement of glucose down its concentration gradient. GLUT1 has a lower KM for glucose (~1 mM) than its family member GLUT2 (~15mM). Except during starvation, the brain uses glucose as its sole metabolic fuel and consumes ~40% of the glucose circulating in the body. Which of the two, GLUT1 or GLUT2, would you expect to find in brain tissue? Explain. (2 points)

I have a one strand DNA sequence that I am trying to determine the base pairs for. The gene is CYP1A2 and the primers and sequence are below.

Below is the sequence of part of the CYP1A2 gene (you are given only 1 strand, written in the 5’ – 3’ direction).

5’TGGGCTAGGTGTAGGGGTCCTGAGTTCCGGGCTTTGCTACCCAGCTCTTGACTTCTGTTTCCCGATTTTA

AATGAGCAGTTTGGACTAAGCCATTTTTAAGGAGAGCGATGGGGAGGGCTTCCCCCTTAGCACAAGGGCA

GCCCTGGCCCTGGCTGAAGCCCAACCCCAACCTCCAAGACTGTGAGAGGATGGGGACTCATCCCTGGAGG

AGGTGCCCCTCCTGGTATTGATAAAGAATGCCCTGGGGAGGGGGCATCACAGGCTATTTGAACCAGCCCT

GGGACCTTGGCCACCTCAGTGTCACTGGGTAGGGGGAACTCCTGGTCCCTTGGGTATATGGAAGGTATCA

GCAGAAAGCCAGCACTGGCAGGGACTCTTTGGTACAATACCCAGCATGCATGCTGTGCCAGGGGCTGACA

AGGGTGCTGTCCTTGGCTTCCCCATTTTGGAGTGGTCACTTGCCTCTACTCCAGCCCCAGAAGTGGAAAC

TGAGATGATGTGTGGAGGAGAGAGCCAGCGTTCATGTTGGGAATCTTGAGGCTCCTTTCCAGCTCTCAGA

TTCTGTGATGCTCAAAGGGTGAGCTCTGTGGGCCCAGGACGCATGGTAGATGGAGCTTAGTCTTTCTGGT

ATCCAGCTGGGAGCCAAGCACAGAACACGCATCAGTGTTTATCAAATGACTGAGGAAATGAATGAATGAA

TGTCTCCATCTCAACCCTCAGCCTGGTCCCTCCTTTTTTCCCTGCAGTTGGTACAGATGGCATTGTCCCA

GTCTGTTCCCTTCTCGGCCACAGAGCTTCTCCTGGCCTCTGCCATCTTCTGCCTGGTATTCTGGGTGCTC

AAGGGTTTGAGGCCTCGGGTCCCCAAAGGCCTGAAAAGTCCACCAGAGCCATGGGGCTGGCCCTTGCTCG

GGCATGTGCTGACCCTGGGGAAGAACCCGCACCTGGCACTGTCAAGGATGAGCCAGCGCTACGGGGACGT

CCTGCAGATCCGCATTGGCTCCACGCCCGTGCTGGTGCTGAGCCGCCTGGACACCATCCGGCAGGCCCTG 3’

The sequences of the primers used to amplify part of the CYP1A2 gene are as follows:

Forward primer: 5’ GAGAGCGATGGGGAGGGC 3’

Reverse primer: 5’ CCCTTGAGCACCCAGAATACC 3’

The restriction enzyme ApaI recognises and cleaves the sequence GGGCC^C (^ indicates where the DNA is cleaved).

I need to determine the fragment sizes for the alleles AA, AC and CC. I believe I have worked out AA (766bp) and CC as (507bp + 259bp), but am stuck on AC

1. TEMPERATURE EFFECTS ON CATALASE

• Results from the temperature experiment—see pg 246, 251 in lab manual):

Table 3: Temperature Effects on Catalase (pg 251 in lab manual):

Follow the same procedure described for enzyme availability to plot the five data series on the same graph (again, scatter plot). Record the reaction rates in table 4 below.