1. All of the following can function as an antioxidant except         (a) Vitamin E  (B) Vitamin B   (C) Vitamin C    (D) selenium
2. This anti oxidant prevents the oxidation and free radicals of LDL            (A) Iron (B) vitamin E (C) Sodium (D) vitamin C
3. We can reduce our risk of developing Cardio Vascular disease, Cancer, stroke, ect..by consuming A lot of                                                                                                      (A) Red meat (B) Milk (C) Won ton soup  (D) Oranges, Carrots, Cantaloupe
4. ANTIOXIDANTS give what to a  free Radical to protect healthy cells?                     a) Proton (B) Electron (c) oxygen (D) an enzyme
5. Free Radicals and oxidative damage can cause (a) cancer (b) inflammation (c) hardening and aging process ( d) all of these

1) An organism is put in a sealed container. The oxygen levels in the container increase and the carbon dioxide levels decrease. What can you conclude about what type of organism it is?

2) Use these eight terms to fill in the blanks:

carbon dioxide, carbon dioxide fixation, G3P, glucose, PGA, Rubisco, RUBP, the Calvin Cycle.

When plants make sugar, they use a group of enzymes found in the stroma to carry out a series of chemical reactions called ____________________________________. First ___________________ combines with _____________________________ due to the enzyme __________________________________. This process of turning an inorganic molecule into an organic one is called ____________________________ and results in an unstable 6-carbon molecule that quickly breaks in half to form __________________________. ATP and NADPH are used to convert these molecules into _____________________________ that can be used to make _________________________________ and remake the original molecule needed to keep the sugar-making going.

You isolate nuclei from three different eukaryotic specis. You treat the samples in exactly teh same way (adding same amount of enzyme, buffer and time) to partially digest the chromatin with micrococcal nuclease, extract the DNA, and run it on a gel. You see the pattern below:

1. Knowing that the core-DNA in all cell types is the same what is your explanation for the difference in size in the patterns you observe?

2. If you digested each of the three samples more thoroughly, what would the pattern look like? (Be specific and indicate what the size of the bands would be)

a. Draw the reaction that takes place when a disulfide bond is formed. What conditions are required for this to occur? What is the major role of disulfide bonds? What kinds of proteins normally have disulfide bonds? Where do you expect to find ribonuclease, the enzyme used in Anfinsen’s famous experiment?

b. Ohm loops are also considered secondary structure. How does their structure differ from other secondary elements? What function do these loops serve? Where are loops typically found on proteins?

c. The fatty acid binding protein and bacterial porin exist in completely different environments, one hydrophobic and one hydrophilic, and also transport molecules with the opposite properties. Describe the structural features these proteins have in common and how this structure can serve these two opposing roles.

The following sequence of 30 nucleotides corresponds to one of the two strands of a double stranded DNA:

5’ GATGTGATCAGACCGGGTGCACTCTAATCT 3’

a) This sequence has two perfect palindromes that consist of 6 base pairs each. What is the sequence of these two palindromes?

b) Show both strands of your FIRST palindrome (indicate the 5’-3’ polarity)

c) Show both strands of your SECOND palindrome (indicate the 5’-3’ polarity)

Assume that the two palindromes are recognized by “6-cutter” restriction enzymes, and that each enzyme creates blunt ends. Assuming the 30bp DNA sequence is digested with BOTH enzymes, and that the resulting dsDNA fragments are stable (i.e. the complementary strands remain annealed):

1. How many fragments would you expect upon digestion?
2. How long would these fragments be (in bp)?

The genetic regulation of the various blood types observed in humans is a great example of

Select one:

a. Codominance

b. Epistasis

c. Incomplete dominance

d. Mendelian genetics

e. Polygenic inheritance

-------------

The main replication enzyme involved in prokaryotic DNA copying is called

Select one:

a. Primase

b. DNA polymerase 1

c. DNA polymerase 2

d. Ligase

e. DNA polymerase 3

------------

The membrane that forms at the end of telophase to separate daughter cells at the end of mitosis in plants is known as

Select one:

a. Cleavage furrow

b. Cytokinetic constriction

c. Mitotic split

d. A septum

e. A cell plate

-------------

The primers that are attached by DNA primase during DNA replication and made of RNA nucleotides

Select one:

a. False

b. True

9. Explain what two types of proteins are transferred from the cytosol to the ER. How are these proteins translocated into the RER? What are some examples of proteins that would fit into each of these two categories?

10. Explain the secretory and endocytic pathways.

11. Explain vesicle budding and protein coats. 12. Explain the basic role of SNARES in vesicle docking.

13. Explain the types of covalent modifications of proteins in the ER and Golgi. Relate these modifications to concepts we have discussed, i.e. di-sulfide bonds.

14. Explain the constitutive and regulated pathways from the Golgi. Include some examples of proteins that would use each pathway.

15. Explain the basics of receptor-mediated endocytosis.

16. Explain the mannose-6-phosphate tag for the enzyme delivery to lysosomes.

If the oxidation of glucose can produce flames, as seen when roasting a marshmallow over a campfire, why don’t we risk internal burns when we swallow a marshmallow and oxidize its glucose with cellular respiration?

Some mountain climbers will take a medication, called acetazolamide (trade name Diamox), starting 24 hours prior to ascending to elevation as a preventative to reduce high altitude sickness. To figure out how this alleviates high altitude sickness, answer the following questions.

1. Around 70% of CO2 is transported in the blood as bicarbonate ions. Draw this reaction.
2. Acetazolamide inhibits the enzyme that catalyzes the reaction between CO2 and H2O and the dissociated ions of carbonic acid (bicarbonate and H+). What effect would this have on blood pH, blood PO2, and blood PCO2?
3. Acetazolamide triggers the kidneys to excrete bicarbonate and increase the respiratory rate. What effect would this have on blood pH, blood PO2, and blood PCO2?
4. Based on these answers, how does this help to prevent high altitude sickness?

Question 3 You are doing genetic studies on a family that has several members with a particular disease. You identify a gene with a one base pair difference (C→T) between the patients (T) and a healthy relative (C). This gene encodes a protein that acts as an enzyme in cellular metabolism.

(A) Describe two ways in which a C→T mutation in the DNA could cause a loss-of-function disruption in a protein.

(B) Describe how it is possible that a loss-of-function mutation can be dominant to wild-type

(C) Describe three potential consequences of a loss-of-function mutation in the protein described in (A). (Answer could be at a cellular or organismal level.)

(D) Describe two ways in which a C→T mutation in the DNA could cause a gain-of-functiondisruption in a protein.