Questions
Question 3: Transcription and Translation Below is the beginning of the coding strand of the protein-coding...

Question 3: Transcription and Translation

Below is the beginning of the coding strand of the protein-coding region of the Cdc7 gene in yeast. Note that only the coding strand of the DNA is shown. Please be sure to correctly label the ends of any DNA, RNA or protein sequence written below.

5’ATGACAAGCAAAACGAAGAATATCGATGATATACCTCCAGAAATCAAAGAAGAGATGA TACAGCTCTATCATGATCTACCGGGTATAGAAAATGAATATAAACTCATAGACAAGATC GGTGAGGGAACATTTTCGTCAGTGTATAAAGCCAAAGATATCACTGGGAAAATAATAG3’

A. What is the sequence of the first 10 nucleotides of the template strand?

B. What is the sequence of the first 10 nucleotides of the mRNA?

C. If this is the coding strand, then is transcription going from right to left or left to right on the DNA as shown here?

D. Is the promoter for this gene to the right or left of this sequence?

E. Given that the coding strand is shown above, what are the first 5 amino acids of the protein that is made from this gene?

F. When you are studying this gene, you notice that there is another potential translation start side downstream of the first one. If the second potential start codon were used as the ribosome “start translation” signal, what would be the first 5 amino acids coded for in this gene?

In: Biology

Which of the following best describes the source of the carbon skeleton for synthesizing non-essential amino...

Which of the following best describes the source of the carbon skeleton for synthesizing non-essential amino acids?

A.    Glutamate

B.     Acetyl coenzyme A

C.     Carbohydrates

D.    Essential amino acids

The use of proteins for energy begins with which of the following processes?

A.    Deamination

B.     Hydroxylation

C.     Oxidation

D. Polymerization

A 56-year-old woman with chronic liver disease is brought to the physician because of confusion, a depressed level of consciousness, personality changes, and intellectual impairment. Laboratory tests support a diagnosis that the woman is suffering from liver encephalopathy. Which of the following blood factors is the most likely cause of this condition?

A.    Ammonia

B.     Ammonium

C.     Arginine

D.    Citrulline

Which of the following substances best describes deaminated alanine?

A.    Acetoacetic acid

B.     Acetyl coenzyme A

C.     Glucose

D.    Lactic acid

E. Pyruvic acid

An increase in blood levels of which of the following substances promotes breakdown of proteins in most tissues?

A.    Estrogen

B.     Glucocorticoid

C.     Growth hormone

D.    Insulin

In: Biology

1.What makes up the spliceosome? What is the function of the spliceosome? 2.What is RNA editing?...

1.What makes up the spliceosome? What is the function of the spliceosome?

2.What is RNA editing? Explain the role of guide RNAs in RNA editing.

3.How do the mRNAs of bacterial cells and the pre-mRNAs of eukaryotic cells differ? How do the mature mRNAs of bacterial and eukaryotic cells differ?

4.Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene contains three exons. Identify the following items and, for each item, give a brief description of its function:

a.5' untranslated region

b.Promoter

c.AAUAAA consensus sequence

d.Transcription start site

e.3' untranslated region

f.Introns

g.Exons

h.Poly(A) tail

i.5' cap

5.A geneticist discovers that two different proteins are encoded by the same gene. One protein has56 amino acids, and the other has 82 amino acids. Provide a possible explanation for how the same gene can encode both of these proteins.

In: Biology

1. The alpha-tubulin molecule is composed of 450 amino acids. What is the minimum number of...

1. The alpha-tubulin molecule is composed of 450 amino acids. What is the minimum number of base pairs of DNA needed to encode the alpha-tubulin molecule?

A. 1350

B. 1335

C. 450

D. 445

2. Compared to a 0.5 M NaCl solution, a 0.2 M NaCl solution is __________.

A. hypotonic

B. hypertonic

C. isotonic

D. neotonic

3. You have identified a frame-shift mutation very near the N-terminus of the protein you are studying. What will be the MOST LIKELY effect on the function of the protein?

A. no effect, as the amino acids are the same, just shifted

B. the protein will be non-functional, as nearly all the amino acids will be different compared to the non-mutated protein

C. the protein will probably not be affected very much as the frame-shift mutation occurs near the end of the protein

4. Which of the following molecules are present in RNA, but not DNA?

A. adenine

B. guanine

C. phosphate group

D. ribose

E. thymine

5. Which of the following processes is central to the initiation of transcription in bacteria?

A. binding of sigma factor to the promoter region of a gene

B. formation of a phosphodiester bond in the elongating RNA strand

C. binding of DNA polymerase to the promoter region

D. formation of a DNA primer

E. binding of RNA polymerase to the enhancer region of a gene

6. Which of the following is false with regards to the DNA repair process in eukaryotes?

A. DNA repair proteins are constantly surveying our cells' DNA for damage and repairing the damage.

B. Damaged DNA can only be repaired during the S phase of the cell cycle.

C. Different kinds of DNA damage requires different DNA repair proteins.

D. A and C are both false.

In: Biology

ara+ and lac+ are genes required for metabolizing the sugars arabinose and lactose, respectively, and ala+...

ara+ and lac+ are genes required for metabolizing the sugars arabinose and lactose, respectively, and ala+ and leu+ are genes required for synthesizing the amino acids alanine and leucine. You are given the following strains:

Strain 1: leu- ala+ ara+ lac+
Strain 2: leu+ ala- ara+ lac-
Strain 3: leu+ ala+ ara+ lac-
Strain 4: leu+ ala- ara- lac-

Which of these strains will grow on minimal media with glucose?

A.

2, 4

B.

2, 3, 4

C.

3

D.

1, 3

E.

1

ra+ and lac+ are genes required for metabolizing the sugars arabinose and lactose, respectively, and ala+ and leu+ are genes required for synthesizing the amino acids alanine and leucine. You are given the following strains:

Strain 1: leu- ala+ ara+ lac+
Strain 2: leu+ ala- ara+ lac-
Strain 3: leu+ ala+ ara+ lac-
Strain 4: leu+ ala- ara- lac-

Which of these strains will grow on minimal media with arabinose?

A.

1

B.

2, 3, 4

C.

2, 4

D.

3

E.

1, 3

ara+ and lac+ are genes required for metabolizing the sugars arabinose and lactose, respectively, and ala+ and leu+ are genes required for synthesizing the amino acids alanine and leucine. You are given the following strains:

Strain 1: leu- ala+ ara+ lac+
Strain 2: leu+ ala- ara+ lac-
Strain 3: leu+ ala+ ara+ lac-
Strain 4: leu+ ala- ara- lac-

Which of these strains will grow on minimal media with lactose + leucine?

A.

3

B.

1, 3

C.

1

D.

2, 3, 4

E.

2, 4

In: Biology

Which type of gel matrix (aka resin) would separate the following proteins using size exclusion chromatography:...

  1. Which type of gel matrix (aka resin) would separate the following proteins using size exclusion chromatography: protein 1 (2,000 Da), protein 2 (7,000 Da), protein 3 (20,000 Da), and protein 4 (90,000 Da)? The answer is C. Please explain the answer!
  1. Gel of range 2,500 – 85,000 Da
  2. Gel of range 8,000 – 200,000 Da
  3. Gel of range 3,000 – 200,000 Da
  4. None of the above

In: Biology

1. The enzyme responsible for recognizing damaged bases in DNA is __________ . a. DNA glycosylase...

1. The enzyme responsible for recognizing damaged bases in DNA is __________ .

a. DNA glycosylase

b. DNA polymerase

c.DNA ligase exonuclease

2. What term is used to describe a species which affects the functioning of an allosteric enzyme?

a. controller

b. inhibitor

c. regulator

d. alloster

3 Which of the following statements is correct?

a. adenine and guanine are both pyrimidines

b. adenine and guanine are both purines

c. adenine is a purine and guanine is a pyrimidine

d. adenine is a pyrimidine and guanine is a purine

5 Movement of a ribosome along a mRNA is termed

a. elongation

b. lateration

c. translocation

d. translation

6 Which of the following will the cause the rate of enzyme activity to increase in a linear fashion (i.e., the activity does not level off, it continually increases)?

a. increasing the pH

b. increasing the substrate concentration

c. increasing the enzyme concentration

d. increasing the temperature

7 Which of the following is true of isozymes?

a. their amino acid sequences are mirror images of one another

b. they are a pair of enzymes which must both be present for enzyme activity to occur

c. they are different forms of the same enzyme found in different tissues

d. none of the above

In: Biology

eschewed EnzymesFurther study of these proteins reveals them to be highly advanced proteins capable of passing...

eschewed EnzymesFurther study of these proteins reveals them to be highly advanced proteins capable of passing through membranes despite their size. Researchers in another lab have managed to create an enzyme that is capable of recognizing an amino acid sequence that is unique to each of these toxic compounds and present on all of them. This enzyme, the researchers named Ripley1, is able to attach a ubiquitin molecule to the toxic proteins. What will happen to these toxins in a cell if they are ubiquitinated?Early treatments of plants with Ripley1 has shown that it has exceptional difficulty localizing itself into the plant cells. What chemical characteristics of this Ripley1 protein are likely preventing it from entering the plant cells?It was observed that animal cells are able to uptake the enzyme Ripley1. What method of cellular eating is most likely being used by these cells to take up the Ripley1 proteins?

In: Biology

1. Under what conditions are ketone bodies formed and what are their uses in the body?...

1. Under what conditions are ketone bodies formed and what are their uses in the body?

2. Mammals are unable to use fatty acids in gluconeogenesis (synthesis of glucose from noncarbohydrate sources) because they lack an enzyme to convert acetyl- CoA to pyruvate. However, recent experimental evidence indicates that certain unusual fatty acids that have odd-numbered carbon chains can be converted to small quantities of glucose. As the odd-carbon chain fatty acid undergoes oxidation, one molecule of propionyl-CoA (3 carbons) is produced during the last cycle. What is the fate of this molecule?

In: Chemistry

The Electron Transport System consists of a series of enzyme complexes that are embedded in the...

The Electron Transport System consists of a series of enzyme complexes that are embedded in the inner mitochondrial membrane. Which one of the following statements is NOT TRUE of mitochondria or the electron transport chain?

a.

Tissues that run aerobic metabolism are enriched in mitochondria.

b.

Glycolysis, the first stage of carbohydrate breakdown, occurs in the inner mitochondrial membrane.

c.

Coenzyme Q10 is a critical electron carrier imbedded in the inner mitochondrial membrane.

d.

The Electron Transport System is the final step in the production of ATP.

In: Biology