1)Which of the following is true of enzyme characteristics? (a) enzymes catalyze reactions when a substrate binds to the allosteric site (b) enzymes catalyze reactions by increasing the activation energy (c) enzymes do not exhibit specificity and a single enzyme can catalyze various different reactions (d) enzymes lower the activation energy of specific reactions, speeding up the reaction rate

2) Microbial growth is measured by what parameter? (a) increased cell size (b) increased size of cellular components (c) increase in total number of cells (d) a & b

3)During aerobic cell respiration, most of the energy is produced during… (a) Krebs cycle (b) glycolysis (c) fermentation (d) electron transport chain

4)Which of the following is the best definition of generation time? (a) the length of time it takes for lag phase to occur (b) the length of time it takes a population of cells to double (c) the minimum length of time it takes a cell to divide (d) the length of time a culture stays in stationary phase

5)Bacteria make exoenyzmes in order to… (a) make structures within the bacterium (b) synthesize large molecules of carbohydrates, proteins, and nucleic acids (c) hydrolyze large molecules to smaller ones so that they can be transported into the bacterium (d) none of the above; bacteria do not make exoenyzmes

6)Which of the following is NOT true of using a spectrophotometer to measure bacterial growth? (a) measurement is based on turbidity of the broth culture (b) this method accounts for both dead and viable cells (c) this method uses the transmission of light through the broth culture to estimate concentration of cells (d) this method requires serial dilutions prior to measurement

answer followings

1.      tRNA aminoacylation

a.      What is aminoacylation? Where on the tRNA does it occur?

b.      Why is ATP required for aminoacylation? Why is the hydrolysis of PPi generated during aminoacylation important?

c.       What is the significance of the high-transfer potential of the ester bond created during tRNA aminoacylation?

d.      Why is the specificity of aminoacyl-tRNA synthetases important? How do these enzymes ensure their specificity?

e.      Are you familiar enough with amino acid side chains to answer questions about aminoacyl-tRNA synthetase specificity? (e.g. how might similar amino acids like valine, serine and threonine be distinguished?)

f.        Do you understand why there are differences in amino acid recognition between activation and editing sites? And how those differences dictate the specificity of the two different activities?

Any Parts answered are greatly appreciated

1. *A PKA value was not provided*

Consider the following peptide, with the sequence in 1-letter code:

CHART. (amino acids: Cytesine, Histidine, Alanine, Arginine, and Theorine, respectively.)

How many chiral atoms (in total) does this peptide contain?

b) If you have a solution containing 1.2 mmol CHART, how many mmol of NaOH will you need to completely titrate this peptide?

c) What is the pI of the peptide CHART?

d) At which pH will CHART have an average net charge of +1.5?

e) Which amino acid side chains in CHART will be H-bond acceptors at pH 8?

f ) Which amino acid side chains in CHART will be H-bond donors at pH 10?

The hunchback gene contains a promoter region, the structural region (the amino acid coding sequence), and a 3' untranslated region (DNA that will be transcribed into sequences appearing at the 3' end of the mRNA that are not translated into amino acids).

a. What important sequences required to control hunchback gene expression are found in the promoter region of hunchback?

b. What sequence elements that encode specific protein domains are found in the structural region of hunchback?

c. There is another important kind of sequence that turns out to be located in the part of the gene transcribed as the 3'UTR (untranslated region) of the hunchback mRNA. What might this sequence do?

48. Answer the following using your own words, do not copy from another source.

A. Define the term enterotoxin and give an example of an organism (Genus and species name) that causes food poisoning and produces an enterotoxin.

B. Define the term cytotoxin and give an example of an organism (Genus and species name) that causes food poisoning and produces a cytotoxin.

50. Choose ONE of the following questions to answer. You can write your answer on a separate sheet of paper and submit as a PDF.

A. You have a population of E. coli and would like to isolate an auxotroph in the population that is deficient in the ability to produce the amino acids histidine and leucine. Design a way to isolate the mutant E. coli cells from a populations of wild type cells.

B. Explain quorum sensing in bacteria. Explain how Vibrio cholera uses quorum sensing to regulate gene expression and cause disease in the human host.

these 5 statements are true or false? thanks

Cytosolic receptors do not bind to hydrophilic signals.

Receptor for epinephrine consists of seven transmembrane helixes.

The enzymatic reaction catalysed by adenylyl cyclase uses ATP.

Amino acids, glucose and triglycerides are taken up by transporters into liver cells.

Decarboxylation occurs when pyruvate is converted to acetyl CoA.

1. A single drop of water has the fate of ending up one day in urine. Once it has become filtrate, it contains glucose, urea, H+, amino acids, Na+, Cl-, K+, and, of course, water. Discuss what happens with each of these, within the context of the three main functions of the nephron (filtration, reabsorption, and secretion).
   1. Use words to explain

The redundancy of the genetic code relates to all of the following EXCEPT

the difference in the number of amino acids compared to the number of base pair combinations

the ability to produce multiple transcripts through alternate splicing

protection of important coding sequences against the effect of point mutations

the ability of tRNAs to base pair with multiple codons through wobble base pairing

Below are the DNA sequences that encode the first eight amino acids for five alleles of the Adh protein in Drosphila pseudoobscura. Nucleotides that differ from the first sequence are shown by a lowercase letter.

ATGTCTCTCACCAACAAGAACGTC

ATGgCTCTCACCAACAAGAACGTC

ATGTCgCTCACCAACAAGAACGTC

ATGTCTtTgACCAACAAGAACGTC

ATGTCTCTCACCAACAAGAACGTg

a. What are the first eight amino acids for each of these five DNA sequences?

b. For each of the five polymorphic sites, indicate whether the site represents a synonymous or nonsynonymous polymorphism.

c. The fourth sequence shown above has two mutational differences from the first sequence. Specifically, the third codon is TTG versus CTC in the first sequence. These two codons are two mutational steps away from each other. Supposing that the CTC sequence gave rise to the TTG sequence, do you think it is more likely that the one-difference intermediate was TTC or CTG?

d. In general, synonymous polymorphisms tend to be more common than nonsynonymous polymorphisms. Why might that be?

d.

to the TTG sequence, do you think it is more

Question 3: Transcription and Translation

Below is the beginning of the coding strand of the protein-coding region of the Cdc7 gene in yeast. Note that only the coding strand of the DNA is shown. Please be sure to correctly label the ends of any DNA, RNA or protein sequence written below.

5’ATGACAAGCAAAACGAAGAATATCGATGATATACCTCCAGAAATCAAAGAAGAGATGA TACAGCTCTATCATGATCTACCGGGTATAGAAAATGAATATAAACTCATAGACAAGATC GGTGAGGGAACATTTTCGTCAGTGTATAAAGCCAAAGATATCACTGGGAAAATAATAG3’

A. What is the sequence of the first 10 nucleotides of the template strand?

B. What is the sequence of the first 10 nucleotides of the mRNA?

C. If this is the coding strand, then is transcription going from right to left or left to right on the DNA as shown here?

D. Is the promoter for this gene to the right or left of this sequence?

E. Given that the coding strand is shown above, what are the first 5 amino acids of the protein that is made from this gene?

F. When you are studying this gene, you notice that there is another potential translation start side downstream of the first one. If the second potential start codon were used as the ribosome “start translation” signal, what would be the first 5 amino acids coded for in this gene?