Put the following events in the order they occur during translation. One event is NOT part of translation, do NOT include it in your sequence.

1. The finished polypeptide, mRNA, and ribosomal subunits separate.
2. A peptide bond is catalyzed between the first and second amino acids.
3. The ribosome moves so that the third codon is in the A site.
4. A second tRNA with brings in the second amino acid.
5. The small ribosomal subunit associates with the mRNA and moves to the correct start location.
6. The stop codon enters the A site.
7. Translation starts by adding the amino acid that corresponds to the codon at the 5' end of the mRNA.
8. Translation starts when tRNA carrying methionine associates with the first AUG from the 5' end of the mRNA.

1. Make a single concept map using ALL of the terms provided below:

*The terms are not in any particular order.

carbohydrate               enzyme                  active site              substrate                     

lactose                         gene                      glucose                  nucleotide

protein                   galactose                     DNA                     activation energy

amino acid            monosaccharide      disaccharide                catalyst

If an enzyme found in human cells would be affected by Sofosbuvir, which eukaryotic enzyme would it most likely affect?

a) DNA Polymerase

b) RNA Polymerase

c) Telomerase

d) Reverse Transcriptase

Thank you!

1) The Hershey Chase experiments in 1928 identified that genetic (heredity) material was comprised of proteins. (True/False)

2) Viruses can cause disease in plants and animals and even bacteria. (True/False)

3) Hershey and Chase were scientists who conducted experiments that demonstrated that DNA is the genetic material of bacteriophages. (True/False)

4) Viruses prefer to reproduce within a host cell but can also reproduce by themselves. (True/False

5) RNA is not absolutely necessary for your cells to make amino acids which make proteins. (True/False)

6) A plasmid is usually circular piece of DNA that can carry genes from one cell to another cell. This process is used in labs to transfer genetic information into host cells to produce valuable medical products.(True/False)

7) Not all segments of RNA are used to make amino acids which then make proteins. The noncoding segments that are cut out of the RNA are called exons. (True/False)

8) The envelope of a flu virus helps the virus open and enter the cell and insert its DNA into the host cell genome. (True/False)

9) Bacteria have the ability to "swap" DNA through the method of conjugation. (True/False)

10) If human is infected with a virus then he or she will show immediate effects. (True/False)

11) Elongation is the process of adding one amino acid to another by peptide bonds during translation. (True/False)

12) Transcription uses a strand of DNA as a template or copy and makes a new strand of RNA which is used to eventually code for proteins. (True/False)

13) Genetic material of a bacteriophage enters a bacterium sort of like a drug is injected with hypodermic needle. (True/False)

14) Mutations found in DNA can have more than one cause and result in many different genetic diseases. (True/False)

15) The AIDS virus is a retrovirus. (True/False)

1.) Calculate the isoelectric point for glu (glutamic acid) and arg (argenine).

Draw structures of the following amino acids and show the form that predominates at pH 4 :

his, arg, trp, pro, tyr.

What is the ratio of acetate/acetic acid in an acetate buffer at pH 5.00?

Construct a concept map by using the terms below. Use branched arrows and/or another concept or two for better linking. Linking phrases must contain a VERB.

Respiration, Amino Acids, O2, CO2, Fermentation, Ammonia, Binary Fission, Photosynthesis, Carbohydrates, Enzymes, Nitrate, Chemolithotrophs

1.How does secretin affect bile and pancreatic juice?

2. How does CCK affect bile and pancreatic juice?

3. How are amino acids, triglycerides, and monosaccharides absorbed in the small intestine?

4. How do bacteria in the large intestine help us?

Which of the following is true about amino acids with isoelectric point around pH 10?

a. the side chain must be acidic

b. the side chain must be basoc

c.the side chain must be polar

d. the side chain must be non polar

e. none of these

Please transcribe and translate the gene provided.   Please provide the code for the non-sense strand of DNA too.

Make sure you label the 3’ and 5’ ends of the nucleic acids, as well as the amino (NH3) group and the carboxyl (COO-) group of the peptide.

3’- CAATAATACGTGAAATAACCTTTATCAACGACGATCAGAGAG –5’

The enzyme that synthesizes the neuropeptide discussed in question 1 is tyrosyl-tRNA synthetase. (PLEASE ANSWER ALL 3 PARTS!!!!!!!!)

A) This enzyme requires ATP to synthesize the dipeptide, but in the ribosome peptide bond synthesis requires no ATP, why?

B) You are a scientist who wants to study this enzyme-outline a set of experiments you would perform to produce recombinant protein.  You must be specific in your strategy. (i.e. you can’t just say that you will purify the protein-you must indicate how).

C) tyrosyl-tRNA synthetase makes a tyrosyl adenylate intermediate (essential an AMP-conjugated to the amino acid). Within the enzyme a Cys 35 hydrogen bonds to the 3’OH in AMP. Draw this hydrogen bond interaction and indicate the impact of mutating the Cys to Ala for this interaction.