Track the ingestion and digestion of a ham-and-cheese sandwich on whole wheat bread with lettuce, green pepper, and tomatoes. Describe the fate of this sandwich from the time you eat it. Be very detailed regarding the digestive process, location, enzyme action, and use of accessory organs of digestion

Describe the synthesis of ATP from ADP and Pi by the F0F1-ATPase.   This enzyme couples two processes – the transfer of protons from out to in and the synthesis of ATP – make sure your story includes some discussion of these two sub reactions and how one is coupled to the other.

1. What is the Nursing Code of Ethics Definition of Respect for Human Dignity?

2. Respect for Human Dignity: Why is it Important in nursing?

3.What is the Franciscan Value Definition of Respect for Human Dignity?

4. Chemical reactions break existing bonds and make new bonds. Enzymes are biological catalysts (proteins) that speed up biological reactions. Just of note, there are only three known biological reactions that can occur at any measurable rate without enzymes – they control everything in biology! Consider the hydrolysis of ATP:

ATP + H2O <--> ADP + Pi

You know that there are MANY biological reactions that use the energy of ATP hydrolysis to power other reactions. Each of these reactions is catalyzed by an enzyme, part of which catalyzes the hydrolysis of ATP (as mentioned in lecture ATP is water is stable for millennia because the uncatalyzed rate is incredibly slow).

List three different things that an enzyme that catalyzes the hydrolysis of ATP might be doing to lower the activation energy and speed up this reaction. Note that your answer does not have to be specific to this reaction but could apply to any biological reaction.

1. During the process of electrophoresis, the ________ functions like a molecular sieve, separating the samples according to their size.

A) agarose gel

B) sample mixture

C) positively charged electrode

D) negatively charged electrode

2. The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below.

AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC
TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG

How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI?

A) four

B) three

C) five

D) two

3. The restriction enzyme BamHI recognizes the DNA sequence GGATCC and always cuts between the two G nucleotides. How many bases long is the sticky end of a DNA molecule that has been cut with BamHI?

A) four

B) three

C) five

D) two

Question 11 pts

When chymotrypsin is assayed with the surrogate substrate p-nitrophenylacetate, a rapid burst of colored product formation (p-nitrophenolate) is observed, corresponding to a relatively steep slope on the A410 vs. time (seconds) plot, followed by a slower-but-steady release of p-nitrophenolate, corresponding to a relatively less-steep slope on the A410vs. time (seconds) plot. These results were interpreted as:

Which amino acid substitutions are most likely to affect structure/function of the protein?

Question 31 options:

Drug A acts by competing with substrate S of the target enzyme. Drug B acts by binding only to the ES complex to form ESB (inactive). If the levels of A and B are fixed, an increase in level S (check all that applied)

Question 35 options:

How many fragments will result from trypsin cleavage of the following peptide?
Asp-Leu-Gln-Arg-Ile-Ala-Met-Trp-Phe-Lys-Gln-Met-Asp-Arg

Question 37 options:

Glucose phosphorylation can be catalyzed by glucokinase or hexokinase. Glucokinase has a Km value of 20.0 mM, whereas hexokinase has a Km value of 0.2 mM. Which of the following statement is true? (check all that applied)

Question 39 options:

Which of the following is true?

Question 40 options:

When designing primers for PCR, scientists often compare the primer sequence to database sequence. This is to ensure that the sequence

Question 46 options:

In an enzyme catalyzed reaction that obeys Michaelis-Menten kinetics, which pair of graphs would illustrate competitive inhibition?
  

Question 47 options:

Facilitated diffusion of membrane transport (check all that applied)

Question 48 options:

a) One international unit of an enzyme is defined as the amount that catalyzes:

A. The formation of one millimole of product in one minute.

B. The formation of one micromole of product in one minute.

C. The formation of one mole of product in one minute.

D. The formation of one micromole of product in one hour.

b) Which of the following expressions is used for determination of K_m?

A. Vo at 1/2 V_max

B. [S] at 1/2 V_max

C. [P] at 1/2 V_max

D. [S] at V_max

c) A protein mixture having MWs of 2, 23, and 40 kilodaltons (kDa) was separated by size exclusion chromatography. Which protein will elute first? Last? Why?

3. The kinetics of an enzyme are studied in the absence and presence of an inhibitor (A). The intial rate is given as a function of substrat concentration in the table.

(a) What kind oof competitor is inhibition is involved (competitive, noncompetitive, uncompetitive)? [Please Provide Graph]

(b) Determine Vmax and Km in the absence and presence of the inhibitor.