4. Chemical reactions break existing bonds and make new bonds. Enzymes are biological catalysts (proteins) that speed up biological reactions. Just of note, there are only three known biological reactions that can occur at any measurable rate without enzymes – they control everything in biology! Consider the hydrolysis of ATP:
ATP + H2O <--> ADP + Pi
You know that there are MANY biological reactions that use the energy of ATP hydrolysis to power other reactions. Each of these reactions is catalyzed by an enzyme, part of which catalyzes the hydrolysis of ATP (as mentioned in lecture ATP is water is stable for millennia because the uncatalyzed rate is incredibly slow).
List three different things that an enzyme that catalyzes the hydrolysis of ATP might be doing to lower the activation energy and speed up this reaction. Note that your answer does not have to be specific to this reaction but could apply to any biological reaction.
In: Chemistry
1. During the process of electrophoresis, the ________ functions like a molecular sieve, separating the samples according to their size.
A) agarose gel
B) sample mixture
C) positively charged electrode
D) negatively charged electrode
2. The restriction enzyme SacI has a recognition sequence of
GAGCT^C, where the caret (^) indicates the cut site. Examine the
DNA molecule below.
AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC
TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG
How many separate molecules of DNA would you end up with if you
treated the above DNA molecule with SacI?
A) four
B) three
C) five
D) two
3. The restriction enzyme BamHI recognizes the DNA sequence GGATCC and always cuts between the two G nucleotides. How many bases long is the sticky end of a DNA molecule that has been cut with BamHI?
A) four
B) three
C) five
D) two
In: Biology
Question 11 pts
When chymotrypsin is assayed with the surrogate substrate p-nitrophenylacetate, a rapid burst of colored product formation (p-nitrophenolate) is observed, corresponding to a relatively steep slope on the A410 vs. time (seconds) plot, followed by a slower-but-steady release of p-nitrophenolate, corresponding to a relatively less-steep slope on the A410vs. time (seconds) plot. These results were interpreted as:
| a) | the rapid release of the first product (p-nitrophenolate), followed by the slower reaction of acetate ion (the other product) with a catalytic lysine residue on the enzyme |
| b) | the unusual properties of aromatic esters and thus not applicable to the normal chymotrypsin mechanism, which involves the hydrolysis of peptide bonds |
| c) | the rapid release of p-nitrophenol, followed by the slower formation of the p-nitrophenolate ion |
| d) | the rapid release of the first product (p-nitrophenolate), followed by the slower hydrolysis of the acyl-enzyme intermediate |
In: Biology
1. What is the Nursing Code of Ethics Definition of Respect for Human Dignity?
2. Respect for Human Dignity: Why is it Important in nursing?
3.What is the Franciscan Value Definition of Respect for Human Dignity?
In: Nursing
In: Economics
Which amino acid substitutions are most likely to affect structure/function of the protein?
Question 31 options:
|
|||
|
|||
|
|||
|
Drug A acts by competing with substrate S of the target enzyme. Drug B acts by binding only to the ES complex to form ESB (inactive). If the levels of A and B are fixed, an increase in level S (check all that applied)
Question 35 options:
|
|||
|
|||
|
|||
|
How many fragments will result from trypsin cleavage of the
following peptide?
Asp-Leu-Gln-Arg-Ile-Ala-Met-Trp-Phe-Lys-Gln-Met-Asp-Arg
Question 37 options:
|
|||
|
|||
|
|||
|
Glucose phosphorylation can be catalyzed by glucokinase or hexokinase. Glucokinase has a Km value of 20.0 mM, whereas hexokinase has a Km value of 0.2 mM. Which of the following statement is true? (check all that applied)
Question 39 options:
|
|||
|
|||
|
|||
|
|||
|
Which of the following is true?
Question 40 options:
|
|||
|
|||
|
|||
|
When designing primers for PCR, scientists often compare the primer sequence to database sequence. This is to ensure that the sequence
Question 46 options:
|
|||
|
|||
|
|||
|
In an enzyme catalyzed reaction that obeys Michaelis-Menten
kinetics, which pair of graphs would illustrate competitive
inhibition?
Question 47 options:
|
|||
|
|||
|
|||
|
|||
|
Facilitated diffusion of membrane transport (check all that applied)
Question 48 options:
|
|||
|
|||
|
|||
|
|||
|
In: Biology
Find the pH of each of the following solutions of mixtures of
acids.
A)0.115 M in HBr and 0.120 M in HCHO2
Express your answer to three decimal places.
B)0.165 M in HNO2 and 9.0×10−2 M in HNO3
Express your answer to two decimal places.
In: Chemistry
If the value of the equilibrium constant, K, for the reaction below is less than 1, what is the strongest base in this system?
HCN (aq) + HCO3¯ (aq) CN¯ (aq) + H2CO3 (aq)
Which of these acids is the strongest in aqueous solution?
a) H3PO4
b) H2SO3
c) HClO3 answer
d) HOCl
In: Chemistry
A 0.21 M solution of a weak base A‑ is made. To a limited extent, the A‑ reacts with H2O to form some OH- and some of the corresponding weak acid HA. If the weak acid has a pKa of 9.4, what will be the pH of the solution (to the nearest hundredths)? For a hint see the Acids and Bases handout on Canvas.
In: Chemistry
Discuss the effect of (a) cholesterol addition, (b) free fatty acid addition, and (c) lysophospholipid addition to a membrane bilayer. Be sure to include an explanation of concentration dependence in biochemical and physical terms. Will your answers to (b) or (c) change if you consider saturated versus unsaturated fatty acids?
In: Chemistry