Questions
The Ruritanian Chemical Company shows the following account balances for the month of May 2017 in...

The Ruritanian Chemical Company shows the following account balances for the month of May 2017 in Ruritanian dollars (R$). Calculate the cost of goods manufactured for May 2017. Also, prepare an income statement for May 2017. ­R$ Customer service cost 800 Direct manufacturing labour 5000 Depreciation plant and equipment 3000 Revenue 51000 Marketing and advertising 1800 Direct materials inventory 1.5.17 3000 Finished goods inventory 31.5.17 6000 Plant repairs and maintenance 3400 Plant utilities 5600 Direct material purchases 7000 Work in progress inventory 31.5.17 4000 Fire insurance plant 800 Indirect materials used 1000 General administrative costs 3000 Depreciation plant building 2000 Work in progress inventory 1.5.17 500 Finished goods inventory 1.5.17 2000 Direct materials inventory 31.5.17 1000 Indirect manufacturing labour 1200 Plant supervision 4000 Miscellaneous plant overhead 1000

In: Accounting

We consider a population of cars from a given model year. A sample of 24 such...

We consider a population of cars from a given model year. A sample of 24 such cars

has been recently sold. The sale price as a function of the age of the car is in the Excel

file S4.XLSX (Car) in the Excel directory.

a. Try a linear regression and an exponential (non-linear) regression with Excel to

fit these data. Comment your results.

b. Which regression model seems to fit the data better and why?

c. Run the LINEST function in Excel. Provide the result table.

Car sale price
Age (year) Price ($)
1 119400
3 73200
5 51000
2 91800
8 36600
2 102000
3 73800
1 120600
6 42600
7 39600
4 61800
8 31200
5 48600
1 126000
5 52800
3 70200
6 43200
6 53400
7 40800
4 63400
7 36000
8 33000
4 64800
2 93000

In: Math

Problem Statement You have the mRNA sequence that results from the transcription of the Homo sapiens...

Problem Statement

You have the mRNA sequence that results from the transcription of the Homo sapiens Hemoglobin subunit beta gene. Knowing that the 5' and 3' ends of the mRNA are processed post-transcriptionally, you know that the start codon and termination codon lie somewhere inside the sequence. A manual inspection of the mRNA sequence should reveal the locations of the start and stop codons, but to ensure you don't miss anything you decide to write a Python script to analyze the mRNA sequence and find the positions of both codons.

You have the mRNA sequence, in the 5' to 3' direction, in a text file:

acauuugcuucugacacaacuguguucacuagcaaccucaaacagacaccauggugcauc
ugacuccugaggagaagucugccguuacugcccuguggggcaaggugaacguggaugaag
uugguggugaggcccugggcaggcugcugguggucuacccuuggacccagagguucuuug
aguccuuuggggaucuguccacuccugaugcuguuaugggcaacccuaaggugaaggcuc
auggcaagaaagugcucggugccuuuagugauggccuggcucaccuggacaaccucaagg
gcaccuuugccacacugagugagcugcacugugacaagcugcacguggauccugagaacu
ucaggcuccugggcaacgugcuggucugugugcuggcccaucacuuuggcaaagaauuca
ccccaccagugcaggcugccuaucagaaagugguggcugguguggcuaaugcccuggccc
acaaguaucacuaagcucgcuuucuugcuguccaauuucuauuaaagguuccuuuguucc
cuaaguccaacuacuaaacugggggauauuaugaagggccuugagcaucuggauucugcc
uaauaaaaaacauuuauuuucauugcaa

From the lecture you know that the canonical start codon is AUG, and you know the 3 stop codons are UAA, UAG, and UGA.

Requirements

We have covered enough Python to accomplish this task. The basic idea is to store the mRNA sequence as a string value, then take advantage of the string's find() function to locate the start codon and the first stop codon. We haven't covered how to read data from a file in Python yet, but you can copy and paste the sequence into a script.

Your script's output should follow the template shown below:

Homo sapiens HBB mRNA:
acauuugcuucugacacaacuguguucacuagcaaccucaaacagacaccauggugcauc
ugacuccugaggagaagucugccguuacugcccuguggggcaaggugaacguggaugaag
uugguggugaggcccugggcaggcugcugguggucuacccuuggacccagagguucuuug
aguccuuuggggaucuguccacuccugaugcuguuaugggcaacccuaaggugaaggcuc
auggcaagaaagugcucggugccuuuagugauggccuggcucaccuggacaaccucaagg
gcaccuuugccacacugagugagcugcacugugacaagcugcacguggauccugagaacu
ucaggcuccugggcaacgugcuggucugugugcuggcccaucacuuuggcaaagaauuca
ccccaccagugcaggcugccuaucagaaagugguggcugguguggcuaaugcccuggccc
acaaguaucacuaagcucgcuuucuugcuguccaauuucuauuaaagguuccuuuguucc
cuaaguccaacuacuaaacugggggauauuaugaagggccuugagcaucuggauucugcc
uaauaaaaaacauuuauuuucauugcaa

Translation start: <position of first AUG codon>

Translation Stop: <position of first stop codon after the start codon>
<stop codon> found at position <Translation stop>

# of amino acids in the HBB protein: <number of amino acids encoded from Translation start to Translation stop>

Commenting

Be sure to comment your code meaningfully! This not only helps you to understand your code, it also helps me understand your thought processes, which is important for awarding partial credit when necessary. Commenting is also one of the rubric items, so if you do not comment your code you will lose points.

Data Storage in the Script

How you store the data inside a script is very important. In general, you want to minimize hardcoding data values, especially if they will be used repeatedly. "Hardcoding" means to use the literal data value in your code instead of storing it in a variable. Every place where a data value is hardcoded represents a potential source of error. If that data value has to be changed, and it is hardcoded, every instance of that value in the script must be changed to avoid errors. If you instead store the value in a variable, and use the variable name in the script instead of the data value itself, you only have to change the data value once, where the variable is initialized.

With this in mind, you should store the following initial data at the top of your script, to be used later:

  1. The mRNA sequence should be stored as a single-line string with no whitespace or line feed characters, in a variable named "HBB_CDS" (short for HBB CoDing Sequence). Although Python allows syntax for storing multiline strings, do not use this syntax, since the line feed characters will be included when you performs searches on the sequence.
  2. The codon length, 3, should be stored in a variable named "Codon_length".
  3. The value of the start codon, "aug", should be stored in a variable named "Start_codon".
  4. The 3 stop codons, "uaa", "uag", and "uga", should be stored in a list. You could use 3 separate variables and store each stop codon separately, but using a list only requires 1 variable, and you can use list indexing to retrieve individual values.

Use of Upper vs. Lower Case

Whether you use upper case or lower case for the sequence data and codons is entirely up to you. Just be sure that you are consistent throughout your script.

Displaying the mRNA Sequence

The first item in the output is the display of the mRNA sequence itself. On one line you should display the species, Homo sapiens, followed by the abbreviation ("HBB") of the gene. Below this line the mRNA sequence itself should be displayed at 60 bases per line, which is the same convention used by GenBank. You do not need to include numbering or spaces every 10 bases like GenBank does, however.

Hint: Use a for loop combined with the range function with an increment of 60, and print each line as a slice, or substring, of 60 bases beginning with the current position in the loop.

Finding and Displaying the Position of the Translation Start Codon

The translation start codon will be the first occurrence of the canonical start codon, AUG, as the mRNA is read from left to right. You can use the string's find() function, which we covered in the Module 1 Python lecture to do this. One important thing to keep in mind is that Python treats strings as 0-based in terms of indexing, meaning the first base in the mRNA is at position 0, not 1. When you display the position of the start codon you must remember to add 1 to the position returned by the find() function, since we read nucleotide sequences as 1-based, with the first base starting at position 1.

Caution: Do not add 1 to the position of the codon when you store it, or you will run the risk of error when you use the position for searches, etc. Only add 1 to the position when you are displaying the codon's position; e.g.:

print("Translation start:", start_codon_pos + 1)

In the example above, the variable, start_codon_pos is not changed; the values of start_codon_pos and the "+ 1" are dynamically added in a different, local variable that is passed as an argument to the print() function, and this local variable is lost once the print() function is done.

Finding and Displaying the Position of the Translation Stop Codon

There are 3 possible stop codons, UAA, UAG, and UGA, and any one of these will signal translation to terminate. You can find the stop codon using a similar approach to finding the start codon. There are a few things to bear in mind, however:

  1. Translation begins at the position of the first AUG codon, so the stop codon must come after the start codon.
  2. You don't know beforehand which stop codon will be the first one encountered, so you must check for all 3 of them. Whichever of the 3 stop codons occurs first after the start codon will be the one that terminates protein synthesis.
  3. Translation reads the mRNA as codons, not individual bases, and codons do not overlap each other. Therefore, when you look for the stop codon you must read the sequence 1 codon, or 3 bases, at a time, with the first codon being the one immediately following the start codon. So if you have the following sequence:

    gggaugacccagaaauaa

    the start codon is at position 4 (in a Python string it will be position 3 since strings are 0-based). Reading the sequence 1 codon at a time to find the stop codon would result in the sequence being read as follows:

    ggg aug acc cag aaa uaa

    The stop codon, UAA, would thus be found at position 13 (index 12 in the Python string).

    If you were to read the sequence one base at a time instead of one codon at a time, you would find a stop codon at position 5 (index 4 in the Python string), which is incorrect.

Be sure to store the position of the stop codon in a variable so you can display it after you have found it.

Hint: This is another good use of a loop with the range function. The range function should begin at the first codon after the start codon, and use an increment of 3 to read the sequence one codon at a time. Inside the loop use an if-elif-elif block to check for each of the stop codons. The stop codons are stored in a list, so you can use list indexes (0, 1, 2) to access individual stop codons. Once a stop codon is found, use the break statement to terminate the loop immediately. Don't forget to store the position of the stop codon in a variable, since you will need to display it.

Calculating and Displaying the Number of Amino Acids in the HBB Protein

Once you have the positions of both the start and stop codons, you can calculate how many amino acids are encoded by the HBB mRNA. Keep in mind the positions of the start and stop codons give the length of the mRNA in bases, not codons, but the number of amino acids will always be equal to the number of codons.

Hint: The math involved here is pretty straightforward, but Python will end up giving you a result that is a floating point value. To convert the floating point value to an integer, use Python's int() function:

int_value = int(floating_point_value)

In: Computer Science

8. Tuberculosis The genus mycobacterium contains over 50 species with several human pathogens of concern. Mycobacteria...

8. Tuberculosis

The genus mycobacterium contains over 50 species with several human pathogens of concern.

Mycobacteria are distinguishable from other types of bacteria by the presence of wax layers and

high molecular weight fatty acids (mycolic acids). This complex, external structure offers

protection from acids, drying and some germicides. In fact, mycobacteria are also referred to as

acid-fast bacilli because acid treatments will not result in decolorization during staining.

One of the mycobacteria species of medical interest is Mycobacterium tuberculosis, the

causative agent of tuberculosis (TB). TB is a disease that affects millions of people worldwide.

In fact, the Center for Disease Control (CDC) estimates that one third of the total world

population is infected with TB.

M. tuberculosis normally attacks the lungs, but can infrequently infect other areas of the body.

An infection with M. tuberculosis can result in latent TB infection or TB disease. Latent TB

infections occur when M. tuberculosis is present but not active. People with latent TB infections

do not exhibit any symptoms, do not feel sick, and are not infectious. If the M. tuberculosis

becomes active and multiplies, the person will develop TB disease.

People with TB disease are infectious. TB is spread primarily by M. tuberculosis becoming

airborne in droplets of respiratory mucus when a person with TB disease coughs, sneezes,

sings or speaks. By breathing in the airborne bacteria, the new person is inoculated. Symptoms

of TB disease include pain in the chest, coughing up blood or sputum, or a bad cough that lasts

three weeks or longer. TB is tested for by either a TB skin test (TST) or by a TB blood test.

Direct identification of acid-fast bacilli in sputum is also used to detect M. tuberculosis. Current

treatments for TB include long term use (6 to 24 months) of a combination of medications.

Questions:

1. What are some of the other symptoms of TB disease not mentioned above?

2. In the U.S., Certain populations have a disproportionate rate of TB. Which populations

are these?

3. How have antibiotic resistant strains of M. tuberculosis hindered treatment?

4. Why are many health care workers required to get tested for TB?

5. A chest x-ray is used occasionally to detect lung damage in TB patients. What is the

radiologist looking for in the x-ray?

6. How are giant African rats being used to detect TB?


7. What other sites in the body can be infected by M. tuberculosis?

8. What is the primary habitat for M. tuberculosis?

In: Biology

1. The restriction enzyme Sau3AI recognizes the following sequence: 5'-GATC-3'. On average, how often should this...

1. The restriction enzyme Sau3AI recognizes the following sequence: 5'-GATC-3'. On average, how often should this enzyme cleave DNA? In contrast, the restriction enzyme Natl recognizes the following sequence: 5'-GCGGCCGC-3'. On average, how often should this enzyme cleave DNA? Does Natl cleave DNA more frequently than Sau3AI?

2. An uncharacterized plasmid DNA was cleaved using several restriction enzymes individually and in various combinations. The DNA fragment sizes were determined by agarose gel electrophoresis and the restriction enzyme recognition sites were mapped. Subsequently, the DNA was sequenced, and an extra recognition site was found for one of the enzymes. However, all the other mapping data was consistent with sequence data. What are the simplest explanations for this discrepancy? Assume the DNA sequence had no errors.

3. A plasmid was cleaved with several restriction enzymes, individually and in combinations. The following fragment sizes (base pairs) were determined by agarose gel electrophoresis.

Note: There may be some slight discrepancy in summing up the total base pairs. Indicate the distances between sites.

Eco RI

4363

Ava I

2182

Pvu II

4363

Pstl

4363

Eco RI -Ava I

2938

1425

Eco RI - Pst I

3609

754

Ava I - Pvu II

3722

641

Ava I - Pst I

2182

Pvu II - Pst I

2820

1543

Eco RI - Pvu II

2297

2066

Make a restriction map based on this data. Hand draw on separate paper and submit the picture of your drawing map.

Note: There may be some slight discrepancy in summing up the total base pairs. Indicate the distances between sites.

4. Why is only one band detected in the Ava I - Pst I co-digest?

In: Biology

AlCl3 and BCl3 are strong Lewis Acids. But, CaCl2 is not a Lewis acid. Explain why....

AlCl3 and BCl3 are strong Lewis Acids. But, CaCl2 is not a Lewis acid. Explain why. (Hint: Write the reactions of these substances with H2O and explain).

In: Chemistry

The same study reported that the following reaction also tends to go forward: AsH2–+ H2S ––––>...

The same study reported that the following reaction also tends to go forward:

AsH2–+ H2S ––––> AsH3+ HS–

Which is the stronger acid, H2S or AsH3? Is this in agreement with the general trends for binary acids? This is an interesting example in that both the trends across the periodic table and down the periodic table are involved. Which has a greater influence, the trend across the table or the trend down the table? Does this fit with what you know about the relative acidities ofbinary acids of the second row (CH4, NH3, OH2, etc) and the halogen group(HF, HCl, HBr, etc.)?

In: Chemistry

1. What are the subunits found in carbohydrates? What are the properties of these subunits? How...

1. What are the subunits found in carbohydrates? What are the properties of these subunits? How do the properties of these subunits influence the structure and properties of carbohydrates?

2. What are the subunits found in proteins? What are the properties of these subunits? How do the properties of these subunits influence the structure and properties of proteins?

3. What are the subunits found in lipids? What are the properties of these subunits? How do the properties of these subunits influence the structure and properties of lipids?

4. What are the subunits found in nucleic acids? What are the properties of these subunits? How do the properties of these subunits influence the structure and properties of nucleic acids?

In: Biology

Use this data: 234 235 345 234 678 56 21 347 674 231 67 89 876...

Use this data:

234 235 345 234 678 56 21 347 674 231 67 89 876 875 457 357 991 667 643

Using the above data do:

Population Mean, Geometric Mean and Population Variance. Also, solve for the Mode and Median

2. Using the first 4 numbers above, solve for

Sample Mean, Sample Variance

3. Using this data:

23 12 4 5 6 7 9 12 34

Solve for Mean, Mode, Median, Population Variance and Geometric Mean

4. Using this data:

44 23 12 16

Solve for the Standard Deviation, Population Variance

In: Statistics and Probability

The table t-value associated with 8 degrees of freedom and used to calculate a 99% confidence...

The table t-value associated with 8 degrees of freedom and used to calculate a 99% confidence interval is _______.

Select one:

a. 3.355

b. 1.860

c. 1.397

d. 2.896

Cameron Sinclair, Information Services Manager with Global Financial Service (GFS), is studying employee use of GFS email for non-business communications. He plans to use a 95% confidence interval estimate of the proportion of email messages that are non-business; he will accept a 0.05 error. Previous studies indicate that approximately 30% of employee email is not business related. Cameron should sample _______ email messages.

Select one:

a. 14

b. 323

c. 457

d. 12

In: Math