Questions
1) Draw the whole cellular respiration cycle: Glycolysis, Bridge Step, and Krebs cycle (don't have to...

1) Draw the whole cellular respiration cycle: Glycolysis, Bridge Step, and Krebs cycle (don't have to draw the molecules, just the names and all of the intermediates).

In: Biology

BIOCHEM Question An inherited mutation can lead to the loss of glucose-6-phosphatase activity. Describe how this...

BIOCHEM Question

An inherited mutation can lead to the loss of glucose-6-phosphatase activity. Describe how this will affect the functioning of glycolysis and gluconeogenesis, and glycogen storage.

In: Biology

An enzyme is 90% destroyed after a thermal treatment of 74oC for 5 h. What is...

An enzyme is 90% destroyed after a thermal treatment of 74oC for 5 h. What is the destruction decay of this enzyme in UHT conditions (135oC, 4 s), knowing that its decay rate is z=32oC?

In: Chemistry

The ABO blood type is determined by different alleles for a gene that codes for an...

  1. The ABO blood type is determined by different alleles for a gene that codes for an enzyme. How do the mutations in the alleles lead to the different blood types?
    Recall that the mutations = alleles affect the active site of the enzyme.

In: Biology

1) What are two ways that enzyme oxidoreductase is controlled in the body? Explain how the...

1) What are two ways that enzyme oxidoreductase is controlled in the body? Explain how the process works
2) What occurs on an allosteric site on an enzyme?
3) What occurs in an irreversible inhibition of an emzyme?

In: Biology

gi|6329444|dbj|AB034757.1| Hynobius retardatus mRNA for larval beta-globin, complete cds GCAGAATCTGACTCAAGAAATCCCTCCTCACCCAACACCACCAGCAGCCATGGTTCACTGGACAGCAGAGGAGAAGGCAGCCATCAGCTCTGTGTGGAAGCAGGTGAACGTGGAGAGCGATGGACAGGAGGCCCTGGCCAGGTTGCTGATCGTCTACCCCTGGAC

gi|6329444|dbj|AB034757.1| Hynobius retardatus mRNA for larval beta-globin, complete cds

GCAGAATCTGACTCAAGAAATCCCTCCTCACCCAACACCACCAGCAGCCATGGTTCACTGGACAGCAGAGGAGAAGGCAGCCATCAGCTCTGTGTGGAAGCAGGTGAACGTGGAGAGCGATGGACAGGAGGCCCTGGCCAGGTTGCTGATCGTCTACCCCTGGACCCAGAGATACTTCAGCTCTTTTGGGGACCTGTCGAGCCCAGCTGCCATTTGTGCCAACGCCAAGGTCCGTGCCCATGGCAAGAAGGTCCTGTCCGCCCTGGGAGCCGGCGCCAACCACCTGGATGACATCAAAGGCAACTTTGCTGATCTGAGCAAGCTTCACGCAGACACACTCCATGTGGACCCCAATAACTTCCTGCTCCTGGCAAACTGCCTGGTGATCGTCTTGGCCCGCAAGCTGGGAGCCGCCTTCAACCCTCAAGTCCATGCGGCCTGGGAGAAGTTCCTGGCCGTCTCCACCGCGGCTCTGTCCAGAAACTACCACTAGAGACTGGTCTTTGGGTTTAATTCTGTGAACGTCCCTGAGACAAATGATCTTTCAATGTGTAAACCTGTCATTACATCAATAAAGAGACATCTAACAAAAAAAAAAAAAAAAAAAAAAAAAA

1) Identify two blunt-end cutters

2) Identify two sticky-end cutters

3) For each,

  1. the sequence of the Restriction enzyme,
  2. highlight using a specific color where the DNA sequence where the restriction enzyme will cut the DNA
  3. indicate the lengths of the DNA fragment after the restriction enzyme cuts the DNA

In: Biology

Consider the enzyme-catalyzed reaction A → B. You determine experimentally that the maximal initial velocity, Vmax,...

Consider the enzyme-catalyzed reaction A → B. You determine experimentally that the maximal initial velocity, Vmax, for the amount of enzyme you have added is 100 units. You also determine that the Michaelis constant, Km, for this enzyme is 80 μM. What concentration of A will give an initial velocity of 60 units? (Note that the units for velocity can be ignored here; they will be relevant in another question. HINT: you need do NO calculations.)

The answer is 120, what is the explanation?

In: Biology

One of the treatments for breast cancer is the administration of selective aromatase inhibitors. Aromatase is...

One of the treatments for breast cancer is the administration of selective aromatase inhibitors. Aromatase is an enzyme involved in the synthesis of various estrogens, such as estrone and estradiol. Aromatase inhibitors can be divided into two categories, type I and type II. Type I inhibitors are irreversible inhibitors of aromatase. Type II inhibitors are competitive inhibitors of aromatase. Given what you know about enzyme inhibition, explain the differences between irreversible and competitive enzyme inhibition.

In: Chemistry

The amino acid leucine has two titratable groups, the α-amino, pKa 9.6 and the α-carboxyl, pKa...

The amino acid leucine has two titratable groups, the α-amino, pKa 9.6 and the α-carboxyl, pKa 2.4. Calculate the ratio of acidic and basic forms and express them as [A]/[HA] ratio or [B]/[BH] of the titrating group at the following pH values: α-carboxyl @ 1.4, 1.9, 2.4, 2.9, 3.4; α-amino @ 8.1, 8.6, 9.1, 9.6, 10.1. Plot pH vs. [B]/[BH] for each group, on the same graph. Compare similarities or disparities in the titration of each group.

In: Chemistry

1) List four outcomes that can result from a Base Substitution in the middle of a...

1) List four outcomes that can result from a Base Substitution in the middle of a gene. For each outcome Explain:

A) What happens to the Amino Acid,

B) Why that happens to the Amino Acid, and

C) How it affects the protein.

2) DO NOT use terms such as “Missense”, “Nonsense”, “Frameshift”. DO NOT write the question in your answer. Do Not Give Examples using bases & codons. If you get a new Amino Acid, discuss side chains, categories, and intermolecular forces.

1.

2.

3.

4.

In: Biology