Questions
What are some differences between the production of glycolysis and gluconeogenesis, and why does gluconeogenesis require...

What are some differences between the production of glycolysis and gluconeogenesis, and why does gluconeogenesis require a higher amount of ATP? Utilize examples and explain thoroughly the differences.

In: Chemistry

how glucagon affect the glycolysis and gluconeogenesis? is any about enzymes (activation/inactivation)will be included on the...

how glucagon affect the glycolysis and gluconeogenesis?

is any about enzymes (activation/inactivation)will be included on the whole reaction? if it is reality, they (the substrate) will produce any product?

thanks

In: Biology

Glycolysis is a catabolic pathway, in which glucose is broken down to generate ATP. Would this...

Glycolysis is a catabolic pathway, in which glucose is broken down to generate ATP. Would this pathway occur when there is high energy charge in the cell? Why/why not?

In: Biology

1) Draw the whole cellular respiration cycle: Glycolysis, Bridge Step, and Krebs cycle (don't have to...

1) Draw the whole cellular respiration cycle: Glycolysis, Bridge Step, and Krebs cycle (don't have to draw the molecules, just the names and all of the intermediates).

In: Biology

BIOCHEM Question An inherited mutation can lead to the loss of glucose-6-phosphatase activity. Describe how this...

BIOCHEM Question

An inherited mutation can lead to the loss of glucose-6-phosphatase activity. Describe how this will affect the functioning of glycolysis and gluconeogenesis, and glycogen storage.

In: Biology

An enzyme is 90% destroyed after a thermal treatment of 74oC for 5 h. What is...

An enzyme is 90% destroyed after a thermal treatment of 74oC for 5 h. What is the destruction decay of this enzyme in UHT conditions (135oC, 4 s), knowing that its decay rate is z=32oC?

In: Chemistry

The ABO blood type is determined by different alleles for a gene that codes for an...

  1. The ABO blood type is determined by different alleles for a gene that codes for an enzyme. How do the mutations in the alleles lead to the different blood types?
    Recall that the mutations = alleles affect the active site of the enzyme.

In: Biology

1) What are two ways that enzyme oxidoreductase is controlled in the body? Explain how the...

1) What are two ways that enzyme oxidoreductase is controlled in the body? Explain how the process works
2) What occurs on an allosteric site on an enzyme?
3) What occurs in an irreversible inhibition of an emzyme?

In: Biology

gi|6329444|dbj|AB034757.1| Hynobius retardatus mRNA for larval beta-globin, complete cds GCAGAATCTGACTCAAGAAATCCCTCCTCACCCAACACCACCAGCAGCCATGGTTCACTGGACAGCAGAGGAGAAGGCAGCCATCAGCTCTGTGTGGAAGCAGGTGAACGTGGAGAGCGATGGACAGGAGGCCCTGGCCAGGTTGCTGATCGTCTACCCCTGGAC

gi|6329444|dbj|AB034757.1| Hynobius retardatus mRNA for larval beta-globin, complete cds

GCAGAATCTGACTCAAGAAATCCCTCCTCACCCAACACCACCAGCAGCCATGGTTCACTGGACAGCAGAGGAGAAGGCAGCCATCAGCTCTGTGTGGAAGCAGGTGAACGTGGAGAGCGATGGACAGGAGGCCCTGGCCAGGTTGCTGATCGTCTACCCCTGGACCCAGAGATACTTCAGCTCTTTTGGGGACCTGTCGAGCCCAGCTGCCATTTGTGCCAACGCCAAGGTCCGTGCCCATGGCAAGAAGGTCCTGTCCGCCCTGGGAGCCGGCGCCAACCACCTGGATGACATCAAAGGCAACTTTGCTGATCTGAGCAAGCTTCACGCAGACACACTCCATGTGGACCCCAATAACTTCCTGCTCCTGGCAAACTGCCTGGTGATCGTCTTGGCCCGCAAGCTGGGAGCCGCCTTCAACCCTCAAGTCCATGCGGCCTGGGAGAAGTTCCTGGCCGTCTCCACCGCGGCTCTGTCCAGAAACTACCACTAGAGACTGGTCTTTGGGTTTAATTCTGTGAACGTCCCTGAGACAAATGATCTTTCAATGTGTAAACCTGTCATTACATCAATAAAGAGACATCTAACAAAAAAAAAAAAAAAAAAAAAAAAAA

1) Identify two blunt-end cutters

2) Identify two sticky-end cutters

3) For each,

  1. the sequence of the Restriction enzyme,
  2. highlight using a specific color where the DNA sequence where the restriction enzyme will cut the DNA
  3. indicate the lengths of the DNA fragment after the restriction enzyme cuts the DNA

In: Biology

Consider the enzyme-catalyzed reaction A → B. You determine experimentally that the maximal initial velocity, Vmax,...

Consider the enzyme-catalyzed reaction A → B. You determine experimentally that the maximal initial velocity, Vmax, for the amount of enzyme you have added is 100 units. You also determine that the Michaelis constant, Km, for this enzyme is 80 μM. What concentration of A will give an initial velocity of 60 units? (Note that the units for velocity can be ignored here; they will be relevant in another question. HINT: you need do NO calculations.)

The answer is 120, what is the explanation?

In: Biology