Questions
Find the closed formula solution to each of the following recurrence relations with the given initial...

Find the closed formula solution to each of the following recurrence relations with the given initial conditions. Use an iterative approach and show your work! What is a_100? a) a_n=a_(n-1)+2,a_0=3 b) a_n=a_(n-1)+2n+3,a_0=4 c) a_n=2a_(n-1)-1,a_0=1 d) a_n=-a_(n-1),a_0=5

In: Advanced Math

1, 1, 1, 1, 1, 3, 3, 3, 3, 6, 6, 6, 7, 7, 7, 12,...

1, 1, 1, 1, 1, 3, 3, 3, 3, 6, 6, 6, 7, 7, 7, 12, 12, 13, 17

1) Use three arguments to explain the character of the shape of the distribution.

2) Determine the presence of outliers in either bound of the distribution by the Fences Criterion.

3) Determine the presence of outliers in either bound using the Z-scores criterion.

4) Summarize data in general.

In: Statistics and Probability

Assume you are a member of the New York City Council prior to the COVID 19...

Assume you are a member of the New York City Council prior to the COVID 19 crisis. The Council is considering placing an excise tax on the following goods

  1. Gasoline
  2. Hot dogs
  3. Tickets to an extremely popular Broadway show
  4. Salt

After hearing that you studied Economics at Ramapo College, the City Council members ask you to select the products that would result in the most efficient tax policy. You recommend...

Group of answer choices

A.1, 2 and 3

B.1, 2, 3 and 4

C.1 only

D.1 and 3

In: Economics

conc of oxalic acid: 0.7550M conc of MnO4=0.13M 3H2C2O4(aq) + 2MnO-4(aq)-------6CO2 (g)+2MnO2(s)+2OH- (aq)+2H2O(l) Experiment # H20...

conc of oxalic acid: 0.7550M

conc of MnO4=0.13M

3H2C2O4(aq) + 2MnO-4(aq)-------6CO2 (g)+2MnO2(s)+2OH- (aq)+2H2O(l)

Experiment # H20 Oxalic Acid KMnO4
1 6 5 1
2 1 10 1
3 5 5 2

Base on the equation and the reactants shown I need to determine:

a)The initial concentration of each reactant. Show calculations

b)final concentration of each reactance, considering:

-which compound is the limiting reactant?Show calculations

-which compound is in excess?Show calculations

In: Chemistry

Q: In MATLAB, make time-domain graphs of a Conventional DSB AM signal u(t) = A_c[1 +...

Q: In MATLAB, make time-domain graphs of a Conventional DSB AM signal u(t) = A_c[1 + am(t)]cos(2×π×f_c×t), with A_c = 1, m(t) = cos(2×π×f_m×t), f_c = 1 kHz, f_m = 50 Hz, for four cases of AM modulations: a = 0, a = 0.3, a = 1, a = 1.3. Your graphs should be over four periods of the message (i.e., 0 < t < 4/fm). Include your code in your solution as well as the four graphs.

In: Electrical Engineering

Using the information given and the equation C = $200B + b(YD), please answer the following...

Using the information given and the equation C = $200B + b(YD), please answer the following questions.

  1. Calculate the value of Consumption (C) using the equation C = $200B + b(YD) (3 points)
  2. What is the value of MPC? (2 points)
  3. What is the value of MPS? (2 points)
  4. What is the value of multiplier M? (2 points)
  5. What happens to the value of multiplier M when MPC increases? (2 points)
  6. What happens to the value of multiplier M when MPS increases? (2 points)
  7. Suppose that investment demand increases by $100 billionin a closed and private economy. Using the multiplier M you calculated in the #4, what will be the final cumulative impact on spending? (4 points)
  8. The action above (aggregate demand increase) will shift the AD curve to the right or left? (1 point)
  9. From your given information, do you have a saving or dissaving? (1 point)
  10. What is the amount of your saving or dissaving? (1 point)

For example, if I were doing this assignment, I would be using the following given information to answer the 8 questions.

C = $200B + b(YD)

b = 0.9

YD = $950B

In: Economics

Consider the following perpetual system merchandising transactions of Belton Company. Use a separate account for each...

Consider the following perpetual system merchandising transactions of Belton Company. Use a separate account for each receivable and payable; for example, record the sale on June 1 in Accounts Receivable—Avery & Wiest.
June 1 Sold merchandise to Avery & Wiest for $9,450; terms 2/5, n/15, FOB destination (cost of sales $6,600).
2 Purchased $4,850 of merchandise from Angolac Suppliers; terms 2/10, n/20, FOB shipping point.
4 Purchased merchandise inventory from Bastille Sales for $11,300; terms 2/15, n/45, FOB Bastille Sales.
5 Sold merchandise to Gelgar for $10,900; terms 3/5, n/15, FOB destination (cost of sales $7,650).
6 Collected the amount owing from Avery & Wiest regarding the June 1 sale.
12 Paid Angolac Suppliers for the June 2 purchase.
20 Collected the amount owing from Gelgar regarding the June 5 sale.
30 Paid Bastille Sales for the June 4 purchase.

Prepare General Journal entries to record the above transactions.

In: Accounting

Even Odd Average (C++ LANGUAGE) Write the following functions: Function #1 Write the function Print. The...

Even Odd Average (C++ LANGUAGE)

Write the following functions:

Function #1

Write the function Print. The function will have one int 1D array n and one int size as parameters. The function will display all the values of n on one line.

Function #2

Write the function AverageEvenOdd. The function will have one int 1D array n and one int size as parameters. The size of the array is given by the parameter int size. Therefore, the function should work on the array of any size. The function will display the sum of all even numbers and odd numbers in n and return the average of all even values and odd numbs in n using two reference parameters.
int main()
{
    int a[7] = {1, 3, 2, 9, 6, 4, 2};
    double aE, aO;
 
    cout<<"a = ";
    Print(a, 7);
    AverageEvenOdd(a, 7, aE, aO);
    cout<<"Average Even: "<<aE<<endl;
    cout<<"Average Odd: "<<aO<<endl<<endl;
 
    return 0;
}

A=1 3 2 9 6 4 2

SUM EVEN=14

SUM ODD=13

AVERAGE EVEN =3.5

AVERAGE ODD=4.33333

 

In: Computer Science

This question is about the Hamming distance (HD). Given a reference DNA sequence and a set...

This question is about the Hamming distance (HD).
Given a reference DNA sequence and a set of candidate sequences, you are going to find out which candidate(s) has/have the Hamming distance smaller or equal to a threshold k.
e.g.
Reference DNA: AATGCGC
Candidate 1: AATCCCC
Candidate 2: TTTGCTC
Candidate 3: AATAAAA
If the Hamming distance threshold k = 3:
HD1 = 2
HD2 = 3
HD3 = 4
Your result should return a list of all the qualified candidate numbers and their Hamming distances in format:
[[candidate number, Hamming distance]].
For the result of the example above:
[[1, 2], [2, 3]]
Here begins the question.
Reference sequence: AGAAACTCTCTGGCCTAAAG

Candidate 1: ACTTAGGTCTCTAAGCCCTC
Candidate 2: AGAAACGTTATGTGGACGTT
Candidate 3: AGTCTGACTCTGATCCAAAG
Candidate 4: AGTCTGCCTTGGCCATTAGC
Candidate 5: GTAAGCTAACCCCGCCAGCA
Candidate 6: AGAAACTCTCTTGTCTAAAG
Candidate 7: AGAAATGATGTCGCCTAAAG
Candidate 8: GCGAATGCGACTGGCGAGGT
Threshold = 11.

Submit the codes you have written to solve the previous question (the one of Hamming distance).
If you are using another language other than Python3, please note which language it is.


In: Computer Science

The long Life Insurance Company receives applications to buy insurance from its salespeople, who are specially...

The long Life Insurance Company receives applications to buy insurance from its salespeople, who are specially trained in selling insurance to new customers. After the applications are received, they are processed through a computer. The computer is programmed so that it prints messages whenever it runs through an item that is not consistent with company policies. The company is concerned with the accuracy of the training that its salespeople received, and it contemplates recalling them for more training if the quality of their performance is blow certain limits. Five samples of 20 applications received from specific market areas were collected and inspected with the following results:

Sample No. of Applications with Errors
1 2
2 2
3 1
4 3
5 2

(1) Find the sample size and average error rate.

(2) Compute three-sigma control limits.

(3) Draw the control chart(s).

(4) There are two new samples were taken each with 20 applications. Four and five applications were found to have mistakes, respectively. Without re-computing the control limits, is the training process out of control?

(5) Is there a need for recalling the sales force? Explain.

In: Operations Management