Internet Writing Assignment:

Perform an Internet search using one or more of the following terms: traceable fixed costs,

common fixed costs, and/or segment margin. Locate an article (less than one year old) from the

results of your search. (Make sure that you do not select an instructor’s lecture notes or a class

assignment from the results of your search.) After reading the article, write two or three

paragraphs that summarize and comment on the article. (Your paper should provide the

appropriate citation(s). If necessary, you may wish to refer to the following website, which

includes information about citations: http://www.cod.edu/library/research/citenet.htm.)

Discuss how the cognitive theorists (Kelly, Beck, and Ellis) might respond to this question from a potential client: "I have been a patient of Dr. Steve Smith, who is a psychoanalyst. He feels that I need three years of therapy to explore my defense mechanisms (he said I need to regress back to my childhood repressions, whatever that means). I am feeling depressed, and have even thought of committing suicide. I feel that no matter what I do, I'm just a complete failure. Can you help me, or should I stay with Dr. Smith?"

(INCLUDE WORK CITED AND IN TEXT CITATIONS)

An organization is typically centered on its mission and vision, but it may not always do as its statement says. Using the provided advanced organizer template, complete the following: List the information about the company Analyze the degree of alignment between what the organization is currently doing (actions) and their mission, vision,values, structure, and culture

Describe the organization in the follow chart:

Analysis

Based on your advanced organizer and further research, analyze the degree of alignment between what the organization is currently doing (actions) and their mission, vision, values, structure, and culture.

Citations

Access the Reference & Citation Generator for citation assistance.

Task 5 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .  

For this task, you will need to search for related literature to _nd your answer. You

must make use of the LNCS referencing style required here:

https://www:springer:com/gp/computer-science/lncs/conference-proceedings-

guidelines.

Look at the guidelines and the templates for reference examples. Failure to provide citations in LNCS style will result in mark forfeiture. You are also limited to use scientific material and books; websites like Wikipedia and StackOverflow are not considered a credible source.

5.1        What are the next developments that are proposed by researchers in the area              (1)

of RAID (not covered in the textbook)? Choose a particular development and

very briefly discuss it. Provide the necessary references for your answer.

In a study of smoking and its effects on sleep patterns, one variable is the time that it takes to fall asleep. A random sample of size 12 is drawn from the population of smokers; an independent sample of size 15 is drawn from the population of non-smokers. The mean time to sleep for smokers is 43.70 minutes; for non-smokers it is 30.32 minutes. The sample variance for the time to sleep for smokers is 286.549 min2  while for non-smokers it is 50.806 min2 .

Find a 95% confidence interval to determine if these data indicate that smokers tend to take longer to fall asleep than non-smokers. (Hint: Degrees of freedom formula yields df = 14.2)

Effects, Politics, and Regulatory Control of Tobacco Use Tobacco use is the primary cause of mortality in the United States today. Tobacco use is responsible for cancer, chronic obstructive pulmonary disease (COPD), asthma, and heart disease and has caused the deaths of nearly half a million people per year. Tobacco control, prevention, and treatment are compelling and urgent public health issues.

The development of tobacco control laws have been passed by a number of states. Write a comprehensive overview of the health effects, politics, and regulatory control of tobacco use control efforts. Your paper should be based on the following points:

What are the factors (biological, environmental, economic, and political) that contribute to tobacco addiction?

What are the medical consequences (morbidity and mortality) for tobacco users?

What is the public health impact (epidemiological and economic) of tobacco use and secondhand smoke exposure?

How do tobacco control regulations relate to positive and normative economics?

How do tobacco control regulations impact individual health care What is the public health policy regarding tobacco control?

What is the role of the state and Federal Government in policy making? What is the history of regulatory tobacco control?

What is the current state of tobacco control in the United States (states that have passed tobacco control regulations)?

What is the evidence that tobacco control is effective?

Based on your understanding, create a 6- to 7-page Microsoft Word document that includes the answers to the above questions. You need a minimum of five scholarly sources that should be in APA format for both in-text citations and citations on the reference page. This assignment requires a title page, an abstract, an introduction, a body, a conclusion, and a reference page.

1. Customer service delivery time: The Alhambra Restaurant in Ottawa, specializing in ethnic fast food, opened for business just one year ago. It has been a hectic first year for the owner as it often is for small business entrepreneurs in their first 12 months of business. Although the year has been somewhat successful (with the owner averaging $1000 net profit per month after all deductions and expenses), the owner is unhappy with the length of time it has been taking staff to provide customer service (service time at the restaurant is measured from the time the customer enters the restaurant to the moment the customer leaves the counter with their completed food order). The design of all aspects of the restaurant from kitchen layout to placement of service counters was supposed to minimize the time required to serve customers. The restaurant design team was convinced that the restaurant design would permit the owner to achieve an average customer service delivery time of approximately 7 minutes. Given the owner’s concern that the design might not be meeting this objective, the design team commissioned a consultant to conduct a small study examining customer service delivery time. A sample of 20 restaurant customers was selected and the customer service delivery time was recorded to the nearest minute (see table below).                  

(a) Does the empirical evidence suggest that it takes significantly longer on average to service customers than the 7 minutes anticipated by the design team? Construct a 90% confidence interval estimate of the average customer service delivery time at the Alhambra? Interpret the meaning of this interval in plain, non-technical language (no jargon). Ensure that your non-technical interpretation of these results clearly, concisely, yet comprehensively addresses the owner’s concerns.

(b)         Write a brief business report communicating what your consulting team has attempted to do to the head of the Alhambra design team. Remember that the head of the design team does not understand statistical jargon. (One of her staff members does understand statistics and will be looking to ensure that you have conducted a good study, that you have performed a valid analysis of your data, and that your interpretation is appropriate for your study results.) Ensure that your report is thorough, comprehensive, clear, yet concise. Evaluation criteria: quality of writing, clarity, usefulness, comprehensiveness, accuracy, completeness, etc. Attach your typed business report to your assignment

1.Why are non-covalent bonds important in biological systems? List at least three examples of non-covalent interactions.

2. You want to amplify at least the underlined sequence, you can have some flanking sequence as well.

      5’CTGCTACGTACTGGATGACTGACTGTGATGATCTGATCCCAGTGCTCGTAGTCGTGCGTTCGTAATATATAGCGATGGCGCGATGCGATGCGCGTAGCGGCTAGGCGTAGGCGGATTCGGCTAGGCGATGGCGATGGCGATGCGATATTCTAGCGCTAGCGATGAGGTGATTATATCGGCGCTAGCTGATCGTAGCTGATCG 3’

Design the most optimal primers according to Tm and length. Write out each primer and show which is the 5’ and 3’ end of each primer.

How big will your PCR product be?

3.. What are the differences between covalent bonds and non-covalent bonds? Where are each found?